View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0123_low_7 (Length: 317)
Name: NF0123_low_7
Description: NF0123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0123_low_7 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 94 - 317
Target Start/End: Complemental strand, 7805708 - 7805485
Alignment:
Q |
94 |
ctcgtattcgttttgatgaattctatagagattgatgtgtccaaatccgggtttttatcaacactatatgtgtggtcatgaaatatttgtaataggttgc |
193 |
Q |
|
|
||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
7805708 |
ctcgtattcgttttgatgaattctatacaggttgatgtgtccaaatccgggtttttatcaacactctatgtgtggtcatgaaatatttgtaataggttgc |
7805609 |
T |
 |
Q |
194 |
ctttggttagagtctagtacttttctttccatcttgaatacaattatacaacacatattgcctggattcctaaaggcgagatcgaaataactatcaagga |
293 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
7805608 |
ctttggttagagtctagtacttttctttccatcttgaatacaattatacaacaaattttgcctggatacctaaaggcgagatcgaaataactatcaagga |
7805509 |
T |
 |
Q |
294 |
ctgaaaaactattgctctttgtaa |
317 |
Q |
|
|
||| |||||||||||||||||||| |
|
|
T |
7805508 |
ctggaaaactattgctctttgtaa |
7805485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University