View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0123_low_8 (Length: 311)
Name: NF0123_low_8
Description: NF0123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0123_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 300
Target Start/End: Original strand, 3543518 - 3543786
Alignment:
| Q |
30 |
cgaacctcttaaggatctgagttcagtttcacttggaccgatcaatattgatatcttgacttgtggttaacattaannnnnnnnacttatcctatatgta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||| |
|
|
| T |
3543518 |
cgaacctcttaaggatctgagttcagtttcacttggaccgatcaatattgatatcttgacttgtggttgacatgaattttttt-acttatcctatatgta |
3543616 |
T |
 |
| Q |
130 |
taaagtatagactatgaatttctttatcaagggtttaattggtaaatttaggtgtgtgttaaatgagtaatatttttctgattgatttgggcaaattaat |
229 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3543617 |
taaagtatagactgtgaatttctttatca-gggtttaattggtaaatttaggtgtgtgttaaatgagtaatatttttctgattgatttgggcaaattaat |
3543715 |
T |
 |
| Q |
230 |
ttttattttgtgaaattaaagctttatataaggaggaggttcaactcaattttctaaacctctagagtatt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3543716 |
ttttattttgtgaaattaaagctttatataaggaggaggttcaactcaattttctaaacctctagagtatt |
3543786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University