View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0124_high_2 (Length: 395)
Name: NF0124_high_2
Description: NF0124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0124_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 30 - 385
Target Start/End: Original strand, 6558159 - 6558521
Alignment:
| Q |
30 |
acaagaactacgattatgacaaatattgctaataaaattatttttggtaacatttgttttttgttattgtttccatagagatgctctttctcttggaact |
129 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6558159 |
acaagaactatgattatgacaaatattgctaataaaattatttttggtaacatttgttttttgttattgtttccatagagatgctctttctcttggaact |
6558258 |
T |
|
| Q |
130 |
tcatttttggaagggttatggagaaagagagaaaacaagagaaaggtataaggaaataggaggataagggaaatgaaagaagttttggactatatattgt |
229 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6558259 |
tcatttttggaagggttatggagaaaaagagaaaacaagagaaaggtgtaaggaaataggaggataagggaaatgaaagaagttttggactatatattgt |
6558358 |
T |
|
| Q |
230 |
gtgtgaagtttatgattttgctttgaattttaattgagtgg----nnnnnnnncttctttctataa---attagcaatgcttcatgttgttttcattgcc |
322 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||| ||| |
|
|
| T |
6558359 |
gtgtgaagtttatgatttttctttgaattttaattgagtggttttttttttcttttctttctataaaccattagcaatgcttcaagttgttttcatagcc |
6558458 |
T |
|
| Q |
323 |
attaatagacttaaatattgtgtatcatgattcatgatatcttaccctttgtgatgttctctg |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6558459 |
attaatagacttaaatattgtgtatcatgattcatgatatcttaccctttgtgatgttctctg |
6558521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1783 times since January 2019
Visitors: 1427