View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0124_low_7 (Length: 281)
Name: NF0124_low_7
Description: NF0124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0124_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 32 - 227
Target Start/End: Original strand, 45147546 - 45147741
Alignment:
| Q |
32 |
gtggaggagcagagagcacgagctgcattatttcttgcttgagttccttcctctgtttatttaatttgtcgagtaaaagttatgtgtggttcccattttc |
131 |
Q |
| |
|
|||| ||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45147546 |
gtggcggatcagtgagcacgagctacattatttcttgcttgagttccttcctctgtttatttaatttgtcgagtaaaagttatgtgtggttcccattttc |
45147645 |
T |
|
| Q |
132 |
tatataagctcgccttgtgtgtgcgtttgctccatcgtctcatccctctccctctgcattttaggtttctgtttgtgagcttagtcatgatgatgt |
227 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
45147646 |
tatataagctcgccttgtgtgtgtgtttgctccatcgtctcatccctctccctctgcagtttaggtttctgtttgtgagcttagtcttgaagatgt |
45147741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 117 - 174
Target Start/End: Complemental strand, 46268369 - 46268312
Alignment:
| Q |
117 |
gtggttcccattttctatataagctcgccttgtgtgtgcgtttgctccatcgtctcat |
174 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
46268369 |
gtggttcccattttctatataagcctgccttgtgtgtgtgtttgctccatcgtctcat |
46268312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1559 times since January 2019
Visitors: 1425