View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0126_low_9 (Length: 287)
Name: NF0126_low_9
Description: NF0126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0126_low_9 |
 |  |
|
[»] scaffold0003 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 52 - 230
Target Start/End: Original strand, 15658542 - 15658720
Alignment:
Q |
52 |
agagctgtttgggagaaatggggttgcacaattatgactgatggttggactgataggaggagaagaactatattgaattttttggtacgtagtccaaagg |
151 |
Q |
|
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
15658542 |
agagctgtttgggagaaatgtggttgcataattatgactgatggttggactgatagaaggagaagaactatattgaattttttggtacatagtccaaagg |
15658641 |
T |
 |
Q |
152 |
gaacttttattttaaagtctattgatgcatctgacattaccaaaattgctgataaattttttaagatgattgatgatgt |
230 |
Q |
|
|
|||||||| ||||||||||||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
T |
15658642 |
gaactttttttttaaagtctattgatccatctgacattaccaaaactgctgataaaatttttaagatgattgatgatgt |
15658720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 52 - 230
Target Start/End: Original strand, 244473 - 244657
Alignment:
Q |
52 |
agagctgtttgggagaaatggggttgcacaattatgactgatggttggactgataggaggagaagaactatattgaattttttggtacgtagtccaaagg |
151 |
Q |
|
|
|||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
244473 |
agagctgtttggaagaaatatggttgcacaattatgaccgatggttggactgataggaggagaagaactatattgaattttttggtacatagtccaaagg |
244572 |
T |
 |
Q |
152 |
gaac-----ttttattttaaagtctattgatgcatctgacattaccaaaattgctgataaa-ttttttaagatgattgatgatgt |
230 |
Q |
|
|
|| | |||| |||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||| |
|
|
T |
244573 |
gagcttttttttttttttaaagtctattgatgcatctgacattaccaaaactgctaataaatttttttaagatgattgatgatgt |
244657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 52 - 230
Target Start/End: Complemental strand, 246020 - 245842
Alignment:
Q |
52 |
agagctgtttgggagaaatggggttgcacaattatgactgatggttggactgataggaggagaagaactatattgaattttttggtacgtagtccaaagg |
151 |
Q |
|
|
|||| |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
T |
246020 |
agagttgtttgggagaaatatggttgcacaattatgaccgatggttggactgataggaggagaagaactatattgaactttttggtacatagtccaaagg |
245921 |
T |
 |
Q |
152 |
gaac-ttttattttaaagtctattgatgcatctgacattaccaaaattgctgataaattttttaagatgattgatgatgt |
230 |
Q |
|
|
|||| |||| |||||||||||||||| |||||| |||||||||||| | |||||||| |||||||||||||||||||||| |
|
|
T |
245920 |
gaacttttttttttaaagtctattga-gcatcttacattaccaaaactcctgataaaatttttaagatgattgatgatgt |
245842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University