View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0126_low_9 (Length: 287)

Name: NF0126_low_9
Description: NF0126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0126_low_9
NF0126_low_9
[»] chr8 (1 HSPs)
chr8 (52-230)||(15658542-15658720)
[»] scaffold0003 (2 HSPs)
scaffold0003 (52-230)||(244473-244657)
scaffold0003 (52-230)||(245842-246020)


Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 52 - 230
Target Start/End: Original strand, 15658542 - 15658720
Alignment:
52 agagctgtttgggagaaatggggttgcacaattatgactgatggttggactgataggaggagaagaactatattgaattttttggtacgtagtccaaagg 151  Q
    |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||    
15658542 agagctgtttgggagaaatgtggttgcataattatgactgatggttggactgatagaaggagaagaactatattgaattttttggtacatagtccaaagg 15658641  T
152 gaacttttattttaaagtctattgatgcatctgacattaccaaaattgctgataaattttttaagatgattgatgatgt 230  Q
    |||||||| ||||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||    
15658642 gaactttttttttaaagtctattgatccatctgacattaccaaaactgctgataaaatttttaagatgattgatgatgt 15658720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 52 - 230
Target Start/End: Original strand, 244473 - 244657
Alignment:
52 agagctgtttgggagaaatggggttgcacaattatgactgatggttggactgataggaggagaagaactatattgaattttttggtacgtagtccaaagg 151  Q
    |||||||||||| ||||||  ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
244473 agagctgtttggaagaaatatggttgcacaattatgaccgatggttggactgataggaggagaagaactatattgaattttttggtacatagtccaaagg 244572  T
152 gaac-----ttttattttaaagtctattgatgcatctgacattaccaaaattgctgataaa-ttttttaagatgattgatgatgt 230  Q
    || |     |||| |||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||    
244573 gagcttttttttttttttaaagtctattgatgcatctgacattaccaaaactgctaataaatttttttaagatgattgatgatgt 244657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 52 - 230
Target Start/End: Complemental strand, 246020 - 245842
Alignment:
52 agagctgtttgggagaaatggggttgcacaattatgactgatggttggactgataggaggagaagaactatattgaattttttggtacgtagtccaaagg 151  Q
    |||| ||||||||||||||  ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||    
246020 agagttgtttgggagaaatatggttgcacaattatgaccgatggttggactgataggaggagaagaactatattgaactttttggtacatagtccaaagg 245921  T
152 gaac-ttttattttaaagtctattgatgcatctgacattaccaaaattgctgataaattttttaagatgattgatgatgt 230  Q
    |||| |||| |||||||||||||||| |||||| |||||||||||| | |||||||| ||||||||||||||||||||||    
245920 gaacttttttttttaaagtctattga-gcatcttacattaccaaaactcctgataaaatttttaagatgattgatgatgt 245842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 8598 times since January 2019
Visitors: 9675