View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0127_high_3 (Length: 202)

Name: NF0127_high_3
Description: NF0127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0127_high_3
NF0127_high_3
[»] chr2 (2 HSPs)
chr2 (113-180)||(14854439-14854506)
chr2 (1-45)||(14854327-14854371)


Alignment Details
Target: chr2 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 113 - 180
Target Start/End: Original strand, 14854439 - 14854506
Alignment:
113 ggtaaactcgtcaccactctcttccaaaccaccggccgcgccaccaacaacttcggctccgttaatat 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14854439 ggtaaactcgtcaccactctcttccaaaccaccggccgcgccaccaacaacttcggctccgttaatat 14854506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 14854327 - 14854371
Alignment:
1 caccgaccctcacctccataaccgctccccctccgctctcgccga 45  Q
    ||||||||||||||||||||||| |||||||||||| ||||||||    
14854327 caccgaccctcacctccataacctctccccctccgccctcgccga 14854371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University