View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0127_low_4 (Length: 202)
Name: NF0127_low_4
Description: NF0127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0127_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 113 - 180
Target Start/End: Original strand, 14854439 - 14854506
Alignment:
| Q |
113 |
ggtaaactcgtcaccactctcttccaaaccaccggccgcgccaccaacaacttcggctccgttaatat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14854439 |
ggtaaactcgtcaccactctcttccaaaccaccggccgcgccaccaacaacttcggctccgttaatat |
14854506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 14854327 - 14854371
Alignment:
| Q |
1 |
caccgaccctcacctccataaccgctccccctccgctctcgccga |
45 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
14854327 |
caccgaccctcacctccataacctctccccctccgccctcgccga |
14854371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1436 times since January 2019
Visitors: 1420