View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0130Ase15 (Length: 107)
Name: NF0130Ase15
Description: NF0130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0130Ase15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 7e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 7e-37
Query Start/End: Original strand, 10 - 101
Target Start/End: Complemental strand, 36800877 - 36800786
Alignment:
| Q |
10 |
aagaggangangaagaacaacaacaacaaaccttcctctttctacctggcttgcttttgttaccttcaacctcgattttctattcttcatta |
101 |
Q |
| |
|
|||| || || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36800877 |
aagaagaagaagaagaacaacaacaacaaaccttcttctttctacctggcttgcttttgttaccttcaacctcgattttctattcttcatta |
36800786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1521 times since January 2019
Visitors: 1423