View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0130Ase15 (Length: 107)

Name: NF0130Ase15
Description: NF0130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0130Ase15
NF0130Ase15
[»] chr4 (1 HSPs)
chr4 (10-101)||(36800786-36800877)


Alignment Details
Target: chr4 (Bit Score: 78; Significance: 7e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 7e-37
Query Start/End: Original strand, 10 - 101
Target Start/End: Complemental strand, 36800877 - 36800786
Alignment:
10 aagaggangangaagaacaacaacaacaaaccttcctctttctacctggcttgcttttgttaccttcaacctcgattttctattcttcatta 101  Q
    |||| || || |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36800877 aagaagaagaagaagaacaacaacaacaaaccttcttctttctacctggcttgcttttgttaccttcaacctcgattttctattcttcatta 36800786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University