View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0130Ase26 (Length: 309)
Name: NF0130Ase26
Description: NF0130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0130Ase26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 8 - 303
Target Start/End: Complemental strand, 30767665 - 30767367
Alignment:
| Q |
8 |
ttcatcnggcttcaatctttggaagcaggtttgtttctgatggattagcnggnttctgcattcctgatacagttcaaggtggagaagagggtcatagagt |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30767665 |
ttcatcaagcttcaatctttggaagcaggtttgtttctgatggattagcaggtttctgcattcctgatacagttcaaggtggagaagagggtcatagagt |
30767566 |
T |
|
| Q |
108 |
ttcttctaatagaccttcttcttctcctaatcacaactgagnnnagttttctatcaggtattattccactgataatattagcataaagttataatctttt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30767565 |
ttcttctaatagaccttcttcttctcctaatcacaactgagcaaagttttctatcaggtattattccactgataatattagcataaagttgtaatctttt |
30767466 |
T |
|
| Q |
208 |
acatatctttagctttatggaacaaatgaataaaactcagcaaaat---tattctcccactcctngttcctttttaaatttctttcatgcatcttatta |
303 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30767465 |
atatatctttagctttatggaacaaatgaataaaactcagcaaaattattattctcccactccttgttcctttttaaatttctttcatgcatcttatta |
30767367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1632 times since January 2019
Visitors: 1426