View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0130Eco15 (Length: 396)
Name: NF0130Eco15
Description: NF0130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0130Eco15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 50 - 389
Target Start/End: Complemental strand, 48879932 - 48879600
Alignment:
| Q |
50 |
gtgattaattgttcaaatgtgttgatggggtcgacttacttaaatgaatatgantgctgtcncaaattttgatttttgtcgacccaggnngtttttactg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
48879932 |
gtgattaattgttcaaatgtgttgatggtgtcgacttacttaaatgaat------gctgtctcaaattttgatttttgtcgatccagggtgtttttactg |
48879839 |
T |
|
| Q |
150 |
gcatttgtggancngaacttgancccggngttgcngtgnttgnatatgnaacaganaacggnatcgattactggttagtgaggaactcatggggttcatc |
249 |
Q |
| |
|
||||||||||| | |||||||| | ||| ||||| ||| ||| ||||| |||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879838 |
gcatttgtggaacagaacttgatcacggtgttgcagtggttggatatggaacagagaacgggatcgattactggttagtgaggaactcatggggttcatc |
48879739 |
T |
|
| Q |
250 |
ntggggtgaaaatggctacattaagatggngagaaatttgttaacaaaagaaactggcaagtgtggaattgcantggaggcatcctatcctatcaagaag |
349 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
48879738 |
atggggtgaaaatggctacattaagatggagagaaatttgttaacaaaagaaactggcaagtgtggaattgcaatggaggcatcatatcctatcaagaag |
48879639 |
T |
|
| Q |
350 |
gntcagaacccaccaaatcctgtttccttcacctccatca |
389 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48879638 |
ggtcagaacccaccaaatcctg-gtccttcacctccatca |
48879600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1522 times since January 2019
Visitors: 1423