View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0130Eco8 (Length: 136)

Name: NF0130Eco8
Description: NF0130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0130Eco8
NF0130Eco8
[»] chr4 (2 HSPs)
chr4 (59-132)||(9910516-9910589)
chr4 (8-56)||(9910406-9910454)


Alignment Details
Target: chr4 (Bit Score: 55; Significance: 5e-23; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 55; E-Value: 5e-23
Query Start/End: Original strand, 59 - 132
Target Start/End: Original strand, 9910516 - 9910589
Alignment:
59 ttaagacatataattatttgcagatgatcttcataatatgaacgangatgcaagctctcaaagctcaacgaatt 132  Q
    |||||||||| || |||||||||||||||||||  |||||||||| ||||||||||||||||||||||||||||    
9910516 ttaagacatagaactatttgcagatgatcttcaatatatgaacgacgatgcaagctctcaaagctcaacgaatt 9910589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 9910406 - 9910454
Alignment:
8 atgtgttctttgtttgcgttttttgtatctttaattttgaacaagaatt 56  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||    
9910406 atgtgttctttgtttgcgttttttgtatctttaattttgaaccagaatt 9910454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University