View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0130Eco8 (Length: 136)
Name: NF0130Eco8
Description: NF0130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0130Eco8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 5e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 5e-23
Query Start/End: Original strand, 59 - 132
Target Start/End: Original strand, 9910516 - 9910589
Alignment:
| Q |
59 |
ttaagacatataattatttgcagatgatcttcataatatgaacgangatgcaagctctcaaagctcaacgaatt |
132 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9910516 |
ttaagacatagaactatttgcagatgatcttcaatatatgaacgacgatgcaagctctcaaagctcaacgaatt |
9910589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 9910406 - 9910454
Alignment:
| Q |
8 |
atgtgttctttgtttgcgttttttgtatctttaattttgaacaagaatt |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9910406 |
atgtgttctttgtttgcgttttttgtatctttaattttgaaccagaatt |
9910454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1465 times since January 2019
Visitors: 1420