View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0130Eco9 (Length: 281)
Name: NF0130Eco9
Description: NF0130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0130Eco9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 5 - 201
Target Start/End: Original strand, 362695 - 362891
Alignment:
| Q |
5 |
acacacaccncnacaaacctaatcactattactgtctaaaataaactgaacatagatattgatggngtactttcaatggtgannnncatcctatcaccaa |
104 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||| || ||||||||||| |
|
|
| T |
362695 |
acacacaccacaacaaacctaatcactattactgtataaaataaactgaacatagatattgatggagtactttcaatgatgaaaaacaacctatcaccaa |
362794 |
T |
|
| Q |
105 |
ttttgacattcctctcctaaatgaacttgcaccaaccaccaactagatatctcttacgtggaatcatgctctttggaaccaacactgttcacaaagc |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
362795 |
ttttgacattcctctcctaaataaacttgcaccaaccaccaactagatatctcttatgtggaatcatgctctttggaacctacactgttcacaaagc |
362891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 24 - 190
Target Start/End: Complemental strand, 41024307 - 41024141
Alignment:
| Q |
24 |
taatcactattactgtctaaaataaactgaacatagatattgatggngtactttcaatggtgannnncatcctatcaccaattttgacattcctctccta |
123 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||| |||||| ||| |||||||||||||||| || |||||||||||||||| ||||||| |||| |
|
|
| T |
41024307 |
taatcactatcactgtctaaaataaaccgaacataaatattgttggagtactttcaatggtgaaaaacaacctatcaccaattttggcattcctgtcctg |
41024208 |
T |
|
| Q |
124 |
aatgaacttgcaccaaccaccaactagatatctcttacgtggaatcatgctctttggaaccaacact |
190 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41024207 |
aatgaacttgcaccaaccactaactagatatctcttatgtggaatcatgctctttggaaccaacact |
41024141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University