View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0130_low_4 (Length: 307)
Name: NF0130_low_4
Description: NF0130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0130_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 4761971 - 4762185
Alignment:
| Q |
1 |
atctgatgtatttgcgcgcagagtataaccaattatttcttttttcctgttaggttttgtgttatttgatctaaagtggttttgcatatatgtaatttta |
100 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4761971 |
atctgatgtatttgcgcgcaaaggataaccgattatttcttttttcctgttaggttttgtgttatttgatctaaagtggttttgcataaatgtaatttta |
4762070 |
T |
|
| Q |
101 |
atggtttctaatttttggaagtgatggaa-ttttctgatgaatttgtgggatttgttttgtttataggtatgaaccagaaattggctctatgttttcttc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4762071 |
atggtttctaatttttggaagtgatggaatttttctgatgaatttgtgggatttgttttgtttataggtatgaaccagaaattggctctatgttttcttc |
4762170 |
T |
|
| Q |
200 |
atggaaatgatgatg |
214 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4762171 |
atggaaatgatgatg |
4762185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1514 times since January 2019
Visitors: 1423