View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_1D_high_12 (Length: 314)
Name: NF0134_1D_high_12
Description: NF0134_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0134_1D_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 54 - 311
Target Start/End: Original strand, 23332595 - 23332852
Alignment:
Q |
54 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
153 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
 |
Q |
154 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacataagtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
253 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23332695 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacatacgtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
23332794 |
T |
 |
Q |
254 |
agctcagcccaaccatcccgcagatagaccttgccatttttcacgtggaccttgacct |
311 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
23332795 |
agctcagcccaaccatcccgcagataaaccttgccatttttcacgtggaccttgacct |
23332852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 59
Target Start/End: Original strand, 23322331 - 23322373
Alignment:
Q |
17 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
59 |
Q |
|
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
T |
23322331 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23322373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 59
Target Start/End: Original strand, 23332498 - 23332540
Alignment:
Q |
17 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
59 |
Q |
|
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
T |
23332498 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23332540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University