View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_1D_high_13 (Length: 294)
Name: NF0134_1D_high_13
Description: NF0134_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_1D_high_13 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 20 - 294
Target Start/End: Original strand, 38815437 - 38815714
Alignment:
| Q |
20 |
caccacacaa-gaggcccttcacggctatttagatctctaggctgtgtaggactaacccagcctctcacacccagcaaaattaaggtgctcgaagctgca |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815437 |
caccacacaaagaggcccttcacggctatttagatctctaggctgtgtaggactaacccagcctctcacacccagcaaaattaaggtgctcgaagctgca |
38815536 |
T |
 |
| Q |
119 |
atgaaggaaatttaaaagccaaatttaagatggctaggggcagaccacaatcaaggcaaaatttccaaca--ctgcctcacaacctggcataaattgggc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
38815537 |
atgaaggaaatttaaaagccaaatttaagatggctaggggaagaccacaatcaaggcaaaatttccaacaccctgcctcacaacctggcataaattggac |
38815636 |
T |
 |
| Q |
217 |
taggggcatggacaatgcgggcagtccaacaacagatctaggatagactccgatatcatcttagggtttgggttgagt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38815637 |
taggggcatggacaatgcgggcagtccaacaacagatctaggatagactccgatatcatcttagagtttgggttgagt |
38815714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 279
Target Start/End: Complemental strand, 25971227 - 25971173
Alignment:
| Q |
225 |
tggacaatgcgggcagtccaacaacagatctaggatagactccgatatcatctta |
279 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| ||| ||| ||||||| |
|
|
| T |
25971227 |
tggacgatgcgggaagtccaacaacagatctaggataggctctgattccatctta |
25971173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 281
Target Start/End: Complemental strand, 18286766 - 18286712
Alignment:
| Q |
227 |
gacaatgcgggcagtccaacaacagatctaggatagactccgatatcatcttagg |
281 |
Q |
| |
|
||||||||||| || || |||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
18286766 |
gacaatgcgggaagcccgacaacagatctacgataggctctgatatcatcttagg |
18286712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University