View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_1D_high_17 (Length: 256)
Name: NF0134_1D_high_17
Description: NF0134_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0134_1D_high_17 |
 |  |
|
[»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 87 - 256
Target Start/End: Original strand, 38815928 - 38816097
Alignment:
Q |
87 |
acttaggccatgtctcttggtcatgcgggactaaacccgacctctcaagtccaacacaatgaaggtgttggaagcgacaatgagggaaaacctaaatgcc |
186 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
38815928 |
acttaggccatgtctcttggtcatgcgggactaaacccgacctctcaagtccaacacaatgaaggtgttggaagcgacaatgagggaaaacccaaatgcc |
38816027 |
T |
 |
Q |
187 |
gcaattaaggtggttagaggcagaccacaattaaagtagaatttcccaacaacagtaaaattaattttaa |
256 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38816028 |
gcaattaaggtggttagaggcagtccacaattaaagtagaatttcccaacaacagtaaaattaattttaa |
38816097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 38815691 - 38815781
Alignment:
Q |
1 |
atcatcttagagtttgggttgagtctaattcaaccctacaaaatcggcttgtcaggtgcgcactgtccaaacttacaagcactactactta |
91 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38815691 |
atcatcttagagtttgggttgagtctaattcaaccctacaaaatcggcttgtcaggtgcgcactgtccaaacttacaagcactactactta |
38815781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 113 - 192
Target Start/End: Original strand, 5424847 - 5424925
Alignment:
Q |
113 |
gggactaaacccgacctctcaagtccaacacaatgaaggtgttggaagcgacaatgagggaaaacctaaatgccgcaatt |
192 |
Q |
|
|
|||||||||||| |||||||| ||||||||||||||||||||| || |||||| |||||||| ||| ||||||||| |
|
|
T |
5424847 |
gggactaaacccaccctctcaaaggcaacacaatgaaggtgttggaggctgcaatgaaggaaaacc-aaaggccgcaatt |
5424925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 43
Target Start/End: Complemental strand, 7252292 - 7252252
Alignment:
Q |
3 |
catcttagagtttgggttgagtctaattcaaccctacaaaa |
43 |
Q |
|
|
||||||||| ||||||||||| |||| |||||||||||||| |
|
|
T |
7252292 |
catcttagaatttgggttgagcctaactcaaccctacaaaa |
7252252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 50
Target Start/End: Complemental strand, 2115576 - 2115530
Alignment:
Q |
4 |
atcttagagtttgggttgagtctaattcaaccctacaaaatcggctt |
50 |
Q |
|
|
|||||| | |||||||||||||||||| |||||||||||| |||||| |
|
|
T |
2115576 |
atcttaaaatttgggttgagtctaattgaaccctacaaaaccggctt |
2115530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 3 - 60
Target Start/End: Original strand, 21048692 - 21048749
Alignment:
Q |
3 |
catcttagagtttgggttgagtctaattcaaccctacaaaatcggcttgtcaggtgcg |
60 |
Q |
|
|
||||||||| ||||||||||| |||| |||||| || ||||| ||||||| ||||||| |
|
|
T |
21048692 |
catcttagaatttgggttgagcctaactcaaccttataaaattggcttgtaaggtgcg |
21048749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 141 - 217
Target Start/End: Complemental strand, 22867069 - 22866994
Alignment:
Q |
141 |
cacaatgaaggtgttggaagcgacaatgagggaaaacctaaatgccgcaattaaggtggttagaggcagaccacaat |
217 |
Q |
|
|
||||| ||||||||||||||| |||||| || |||| |||| ||||||||||||| | ||| ||||||||||||| |
|
|
T |
22867069 |
cacaacgaaggtgttggaagctgcaatgaaggcaaac-taaaggccgcaattaaggcgactaggggcagaccacaat |
22866994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University