View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_1D_high_21 (Length: 222)
Name: NF0134_1D_high_21
Description: NF0134_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_1D_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 11 - 55
Target Start/End: Complemental strand, 39076841 - 39076797
Alignment:
| Q |
11 |
atgaatagaaccgggtttatggttaattcgcctgcgtttcatggc |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39076841 |
atgaatagaaccgggtttatggttaattcgcctgcgtttcttggc |
39076797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2012 times since January 2019
Visitors: 1439