View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_1D_low_14 (Length: 294)
Name: NF0134_1D_low_14
Description: NF0134_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_1D_low_14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 35993878 - 35993585
Alignment:
| Q |
1 |
aataaggtgtttagtacaatattgtcaaatggtggcactgtagtagtgttacgtagaagaatttaaacaaatgcctattttctgcctgctgcgattgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35993878 |
aataaggtgtttagtacaatattgtcaaatggtggcactgtagtagtgttacgtagaagaatttaaacaaatgcctattttctgcctgctgcgattgtaa |
35993779 |
T |
|
| Q |
101 |
atactggttttgtttgttattcattaatgttttgtgttgctaaatttttagatatgaaggaactctttgggatgatattgctcaaggaaaaggtgtttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35993778 |
atactggttttgtttgttattcattaatgttttgtgttgctaaatttttagatatgaaggaactctttgggatgatattgctcaaggaaaaggtgtttat |
35993679 |
T |
|
| Q |
201 |
acttctccagatgggcttgtcaggtttgtctttgctacattgttttggcatgcagttagtgctgttagttgtgcttaaatggtttaggtggtag |
294 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35993678 |
acttctccagatggacttgtcaggtttgtctttgctacattgttttggcatgcagttagtgctgttagttgtgcttaaatggtttaggtggtag |
35993585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 130 - 234
Target Start/End: Complemental strand, 9757435 - 9757330
Alignment:
| Q |
130 |
ttttgtgttgctaaatttttagatatgaaggaactctttgggatgatattgctcaaggaaaa--ggtgtttatacttctccagatgggcttgtcaggttt |
227 |
Q |
| |
|
||||||| |||||||||||||| |||||||| | | ||||| |||||||||||||||||||| ||||||||| ||||| | |||||||||||||||| |
|
|
| T |
9757435 |
ttttgtgatgctaaatttttagttatgaaggcatt-tttggtatgatattgctcaaggaaaaaaggtgtttatgcttcttaaattgggcttgtcaggttt |
9757337 |
T |
|
| Q |
228 |
gtctttg |
234 |
Q |
| |
|
||||||| |
|
|
| T |
9757336 |
gtctttg |
9757330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1940 times since January 2019
Visitors: 1435