View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_1D_low_21 (Length: 265)
Name: NF0134_1D_low_21
Description: NF0134_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0134_1D_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 80 - 189
Target Start/End: Complemental strand, 22624939 - 22624829
Alignment:
Q |
80 |
ttggagttcctcagtctgagtagtgt-gagatatgcatattgttccaggattttggtcgctgtattttgagtgaaaagttgatgtaacaattaatagaga |
178 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22624939 |
ttggagttcctcagtctgagtagtgttgagatatgcatattgttccaggattttggtcgctgtattttgagtgaaaagttgatgtaacaattaatagaga |
22624840 |
T |
 |
Q |
179 |
tgtccatctca |
189 |
Q |
|
|
||| ||||||| |
|
|
T |
22624839 |
tgtgcatctca |
22624829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 105 - 181
Target Start/End: Original strand, 32285984 - 32286060
Alignment:
Q |
105 |
tgagatatgcatattgttccaggattttggtcgctgtattttgagtgaaaagttgatgtaacaattaatagagatgt |
181 |
Q |
|
|
|||||||||||||||||| ||||||||| ||||||||||||||| |||||||||| | || | ||||||||| |
|
|
T |
32285984 |
tgagatatgcatattgttttcggattttggctgctgtattttgagtggggagttgatgtatccatcagtagagatgt |
32286060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2031 times since January 2019
Visitors: 1439