View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_1D_low_26 (Length: 238)
Name: NF0134_1D_low_26
Description: NF0134_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_1D_low_26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 50492174 - 50492412
Alignment:
| Q |
1 |
tcaacgggagcttcgtcgtcttcagatgcg-ggctggtgtgagtgtgaggaagttgatcagtgttgaaaccggcggatggtgaggttggtgaatcgggag |
99 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50492174 |
tcaacggaagcttcgtcgtcttcagatgcgcggctggtgtgagtgtgaggaagttgatcagtgttgaaaccggcggatggtgaagttggtgaatcgggag |
50492273 |
T |
|
| Q |
100 |
ttgatgcaggattttctggatccatgattcttcgcttcttctcttctagctctgaagtgtttcaatttcagttttgctctgaagaattcgattgtgtgtt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
50492274 |
ttgatgcaggattttctggatccatgattcttcacttcttctcttctagctctgaagtgtttcaatttcagtttcgctctgaataattcgattgtgtgtt |
50492373 |
T |
|
| Q |
200 |
tagggttgcaacttccgagggtttatcaatgggtgctgg |
238 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50492374 |
tagggttgcaacttccgaggggttatcaatgggtgctgg |
50492412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1818 times since January 2019
Visitors: 1430