View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0134_1D_low_29 (Length: 222)

Name: NF0134_1D_low_29
Description: NF0134_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0134_1D_low_29
NF0134_1D_low_29
[»] chr2 (1 HSPs)
chr2 (11-55)||(39076797-39076841)


Alignment Details
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 11 - 55
Target Start/End: Complemental strand, 39076841 - 39076797
Alignment:
11 atgaatagaaccgggtttatggttaattcgcctgcgtttcatggc 55  Q
    |||||||||||||||||||||||||||||||||||||||| ||||    
39076841 atgaatagaaccgggtttatggttaattcgcctgcgtttcttggc 39076797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University