View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_1D_low_36 (Length: 208)
Name: NF0134_1D_low_36
Description: NF0134_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0134_1D_low_36 |
 |  |
|
[»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 33 - 208
Target Start/End: Original strand, 38814608 - 38814783
Alignment:
Q |
33 |
acatcaatcaactgtgcctcctccaagaaattgggatcctgaaatttcacatgcagctcatcaggttgaatgtctagaagtactggttcttccctgacaa |
132 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38814608 |
acatcaatcaactgtgcctcctccaagaaattgggatcttgaaatttcacatgcagctcatcaggttgaatgtctagaagtactggttcttccctgacaa |
38814707 |
T |
 |
Q |
133 |
ttaatggagtaaatttacaaggcatgagaaactcattaaaacaaacaactactatcatcccataaggtgatgttgg |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38814708 |
ttaatggagtaaatttacaaggcatgagaaactcattaaaacaaacaactactatcatcccataaggtgatgttgg |
38814783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 33 - 127
Target Start/End: Original strand, 38821066 - 38821160
Alignment:
Q |
33 |
acatcaatcaactgtgcctcctccaagaaattgggatcctgaaatttcacatgcagctcatcaggttgaatgtctagaagtactggttcttccct |
127 |
Q |
|
|
|||||||| ||||||||||||| | |||| |||||||| |||| ||||||||||||||||||||||||||||||| ||| ||| | ||||||||| |
|
|
T |
38821066 |
acatcaattaactgtgcctccttcgagaagttgggatcttgaagtttcacatgcagctcatcaggttgaatgtcttgaaatacagattcttccct |
38821160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University