View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_1D_low_37 (Length: 206)
Name: NF0134_1D_low_37
Description: NF0134_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0134_1D_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 3469514 - 3469695
Alignment:
Q |
18 |
caacagagatccacaggctgtgaatgttgagtagagttctatggaccaggtttacctgtttgtttgatgccaaacaatcctcttagtgtttttgagccac |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3469514 |
caacagagatccacaggctgtgaatgttgagtagagttctatggaccaggtttacctgtttgtttgatgccaaacaatcctcttagtgtttttgagccac |
3469613 |
T |
 |
Q |
118 |
caactattttattaccaatgtaaaaccaaggacaaattgcatattccattttgtatctcagtagtggcttagatgtccatct |
199 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3469614 |
caactattttattaccaatgtaaaatcaaggacaaattgcatattccattttgtatctcagtagtggcttagatgtccatct |
3469695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University