View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_1D_low_8 (Length: 365)
Name: NF0134_1D_low_8
Description: NF0134_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_1D_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 5 - 353
Target Start/End: Complemental strand, 3776161 - 3775813
Alignment:
| Q |
5 |
tccaatgagatggacatcacggcaaaagccaaggggcactgggatagtacggaacttgcggttggaagctttgacaatttggcataacttgttcaacaga |
104 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3776161 |
tccattgagatggactccacggcaaaagccaaggggcactgggatagtacggaacttgtggttggaagctttgacaatttggcataacttgttcaacaga |
3776062 |
T |
 |
| Q |
105 |
actgctggcagctgcatcttctgtcagcgttgttgatgtgtcagaagatttgatggaatgttcatcactcttttcttccccaacatagggtacatgaatc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3776061 |
actgctggcagctgcatcttctgtcagcgttgttgatgtgtcagaagatttgatggaatgttcatcactcttttcttccccaacatagggtacatgaatc |
3775962 |
T |
 |
| Q |
205 |
tgcagtgcttccggtctaatgaatccgtttttcggggaaatattaactccttgatcagcaaggttcaatgcagattccattgattcacacaaaggggtat |
304 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3775961 |
cgcagtgcttccggtctaatgaatccatttttctgggaaatattaactccttgatcagcaaggttcaatgcagattccattgattcacacaaaggtgtat |
3775862 |
T |
 |
| Q |
305 |
cggtcctgaatgtaaagactgtgccattacagtttagtgaaggatgatg |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3775861 |
cggtcctgaatgtaaagactgtgccattacagtttagtgaaggatgatg |
3775813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University