View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_high_13 (Length: 305)
Name: NF0134_2D_high_13
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0134_2D_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 57 - 284
Target Start/End: Complemental strand, 11681088 - 11680861
Alignment:
Q |
57 |
tttttccaatttcttttaaggacaccatccaacaaatactcagtttgaatcaatgagttcagtggtgtgatgagattgacccttaactaagagaatcatt |
156 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11681088 |
tttttccaatttcttttaaggacaccatccaacaaatactcagtttgaatcaatgagttcagtggtgtgatgagattgacccttaactaagagaatcatt |
11680989 |
T |
 |
Q |
157 |
tcgcccacaataaggcagtaaccggctagtgcaggaaaaggtgaagggcagtctcctctccattggttcaaaaaacacattcaactgcaacctcaagatc |
256 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
11680988 |
tcgcccacaataaggcagtaaccggctagtgcaggaaaaggtgaagggcagtctcctctccattggttcaaaaaacacattcatctgcaacctcaagatc |
11680889 |
T |
 |
Q |
257 |
gaaacaaataaacgtttatccctgccat |
284 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
11680888 |
gaaacaaataaacgtttatccctgccat |
11680861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 11681085 - 11681145
Alignment:
Q |
1 |
aaaaggctattggcttatttcgcatgcggctatatgaaaggcgcgaaatggaatgattttt |
61 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11681085 |
aaaaggctattggcttatttggcatgcggctatatgaaaggcgcgaaatggaatgattttt |
11681145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University