View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_high_16 (Length: 294)
Name: NF0134_2D_high_16
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_2D_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 568726 - 569008
Alignment:
| Q |
1 |
cccaccatggtacgtgagtttcagtcagtgattgggaaagaaacaaggaaacaagcatgggaaaaatggggaggaaaaccagacattattgttgcaagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
568726 |
cccaccatggtacgtgagtttcagtcagtgattgggaaagaaacaaggaaacaagcatgggaaaaatggggaggaaaaccagacattattgttgcaagtg |
568825 |
T |
 |
| Q |
101 |
ttggaacaggttcaaatgctttaggtatgttccatgagtttctatcagacatagatgtgagattgattggagttgaagctgctggtttagggttagaaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
568826 |
ttggaacaggttcaaatgctttaggtatgttccatgagtttctatcagacacagatgtgagattgattggagttgaagctgctggtttagggttagaaag |
568925 |
T |
 |
| Q |
201 |
tggaaaacattcttccactttggccaaaggagaaatgggtgtttatcatggtgctatctcctatttattacaagatggtgatg |
283 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
568926 |
tggaaaacattcttccactttaaccaaaggagaaatgggtgtttatcatggtgctatctcctatttattacaagatggtgatg |
569008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 7 - 104
Target Start/End: Original strand, 20172445 - 20172542
Alignment:
| Q |
7 |
atggtacgtgagtttcagtcagtgattgggaaagaaacaaggaaacaagcatgggaaaaatggggaggaaaaccagacattattgttgcaagtgttgg |
104 |
Q |
| |
|
|||||| | |||||||| ||||||| |||||||||||||| || ||||||| ||||||||||||||| || ||||| ||| | || ||| ||||||| |
|
|
| T |
20172445 |
atggtaagagagtttcatgcagtgatagggaaagaaacaagaaagcaagcattggaaaaatggggagggaagccagatattctagtagcatgtgttgg |
20172542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University