View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_high_20 (Length: 263)
Name: NF0134_2D_high_20
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0134_2D_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 71 - 260
Target Start/End: Complemental strand, 25700802 - 25700613
Alignment:
Q |
71 |
ggcgacgactaggtagtctaaagaagcagtggcagatgacaatcgcaagaggaccgnnnnnnngattgacacatttgtgtgagagaagagttgaggaagg |
170 |
Q |
|
|
|||||| |||||||||||||||||||| ||||||||||||| ||||| |||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
T |
25700802 |
ggcgaccactaggtagtctaaagaagcggtggcagatgacagtcgcaggaggaccgaaaaaaagattgacgcatttgtgtgagagaagagttgaggaagg |
25700703 |
T |
 |
Q |
171 |
aatatgatacaaccaggtctagaatagactcattctccaactgtgggtgacatgtattacttttccagatagaggtgccttcttattcat |
260 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
25700702 |
aatatgatacaaccaggtctagaatagactcattctccaactgtgggtgacatgtattactttcccagatagaggtgccttcttattcat |
25700613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 18 - 88
Target Start/End: Complemental strand, 25700892 - 25700822
Alignment:
Q |
18 |
gaattaaatcatcgataaaacaagggatgtaattggaagaagtggtgtagagtggcgacgactaggtagtc |
88 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
25700892 |
gaattaaatcatcgataaaacaagggatgtaattggaagaagtggtgtagagcggcgacgactaggtagtc |
25700822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University