View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_high_21 (Length: 259)
Name: NF0134_2D_high_21
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0134_2D_high_21 |
 |  |
|
[»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 24494192 - 24493954
Alignment:
Q |
1 |
ctttgagatagatgaataatgatggatcagatttggaattgacaaacccataggagagtaagaaagaatgtaaggtgttaaaccatgcccgaggggcctg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24494192 |
ctttgagatagatgaataatgatggatcagatttggaattgacaaacccataggagagtaagaaagaatgtaaggtgttaaaccatgcccgaggggcctg |
24494093 |
T |
 |
Q |
101 |
ttttaggccatacaaagatttctttagccgacaaacatgattagggtaatctggatgatgaaatcccggtggttgttgcatgtatacagtttctgaaagc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
24494092 |
ttttaggccatacaaagatttctttagccgacaaacatgattagggtaatctggatgatgaaatcccggtggttgttgcatgtatacaatttctgaaagc |
24493993 |
T |
 |
Q |
201 |
ttaccatgcaagaacgcattgtttacatccaactggtga |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24493992 |
ttaccatgcaagaacgcattgtttacatccaactggtga |
24493954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 93542 - 93304
Alignment:
Q |
1 |
ctttgagatagatgaataatgatggatcagatttggaattgacaaacccataggagagtaagaaagaatgtaaggtgttaaaccatgcccgaggggcctg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
93542 |
ctttgagatagatgaataatgatggatcagattttgaattgacaaatccataggagagtaagaaagaatgtaaggtgttgaaccatgcccgaggggcctg |
93443 |
T |
 |
Q |
101 |
ttttaggccatacaaagatttctttagccgacaaacatgattagggtaatctggatgatgaaatcccggtggttgttgcatgtatacagtttctgaaagc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
93442 |
ttttaggccatacaaagatttctttagccgacaaacatgattagggtaatctagatgatgaaatcctggtggttgttgcatgtatacagtttctgaaagc |
93343 |
T |
 |
Q |
201 |
ttaccatgcaagaacgcattgtttacatccaactggtga |
239 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
93342 |
ttaccatgcaagaacacattgtttacatccaactggtga |
93304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2023 times since January 2019
Visitors: 1439