View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0134_2D_high_30 (Length: 214)

Name: NF0134_2D_high_30
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0134_2D_high_30
NF0134_2D_high_30
[»] chr5 (1 HSPs)
chr5 (6-136)||(3002552-3002682)


Alignment Details
Target: chr5 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 6 - 136
Target Start/End: Original strand, 3002552 - 3002682
Alignment:
6 accttttgcatggtgattttttgtgtgctcaattatgacataatcctatcctgtttggcatagtatttgaaactctcaatcctttgtcagcgatggatgt 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3002552 accttttgcatggtgattttttgtgtgctcaattatgacataatcctatcctgtttggcatagtatttgaaactctcaatcctttgtcagcgatggatgt 3002651  T
106 cgatggaatgagatatggttgcttgctggtg 136  Q
    ||||||||||||| |||||||||||||||||    
3002652 cgatggaatgagagatggttgcttgctggtg 3002682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2013 times since January 2019
Visitors: 1439