View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_high_5 (Length: 430)
Name: NF0134_2D_high_5
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_2D_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 399; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 399; E-Value: 0
Query Start/End: Original strand, 1 - 403
Target Start/End: Original strand, 41735701 - 41736103
Alignment:
| Q |
1 |
agccaggtcatcatgcacctcagtgcaaacatcgcaagaggaaagacaatcctcttaaagctaacttgactgaatgaggtgacactattgatgtggttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735701 |
agccaggtcatcatgcacctcagtgcaaacatcgcaagaggaaagacaatcctcttaaagctaacttgactgaatgaggtgacactattgatgtggttaa |
41735800 |
T |
 |
| Q |
101 |
ttataaattgtttggaatgggagctgggaggtgcatgatgatatggattaccacaaacataactaattttcttttgcaggtgagattaataacatgagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735801 |
ttataaattgtttggaatgggagctgggaggtgcatgatgatatggattaccacaaacataactaattttcttttgcaggtgagattaataacatgagga |
41735900 |
T |
 |
| Q |
201 |
acataattgttattactattgtgattaggcttgtgatcatgactctttttgtgagaattattatgagtcttcagattttcttggtagctaaagccttcgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735901 |
acataattgttattactattgtgattaggcttgtgatcataactctttttgtgagaattattatgagtcttcagattttcttggtagctaaagccttcgc |
41736000 |
T |
 |
| Q |
301 |
cttgacagccttgctcttctttcagttggtaccttcgaaactcacgtggaaaataatatttttcatgtttgaattcttccaacagtttgtggtaattgtt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41736001 |
cttgacagccttgctcttctttcagttggtaccttcgaaactcacgtggaaaataatatttttcatgtttgaattcttccaacagtttgtggtaattgtt |
41736100 |
T |
 |
| Q |
401 |
gat |
403 |
Q |
| |
|
||| |
|
|
| T |
41736101 |
gat |
41736103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University