View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_low_16 (Length: 377)
Name: NF0134_2D_low_16
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_2D_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 1e-63; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 120 - 281
Target Start/End: Complemental strand, 43557170 - 43557003
Alignment:
| Q |
120 |
atgtatttatgatgaatgttcctgataataattaaa-----acatatgaatttaattttaatgatttactactat-atagattagggactataaaattgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| || || | |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43557170 |
atgtatttatgatgaatgttcctgataacaactacaggaatacatatgaatttaattttaatgatttactactattatagattagggactataaaattgg |
43557071 |
T |
|
| Q |
214 |
taggcgtacatgctcatagaaagaagacttaaaatttggtagattcggctcttgtttcaaaaccaata |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43557070 |
taggcgtacatgctcatagaaagaagacttaaaatttggtagattcggctcttgtttcaaaactaata |
43557003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 280 - 351
Target Start/End: Complemental strand, 43556866 - 43556795
Alignment:
| Q |
280 |
tatgttgtatatgaattttaaaaaataaactaaaatccgatcgaactgttgataaatatagatttcttcacc |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
43556866 |
tatgttgtatatgaattttaaaaaataaactaaaatccgatcgaaccgttgataaatatagatttattcacc |
43556795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 35 - 81
Target Start/End: Complemental strand, 43557207 - 43557161
Alignment:
| Q |
35 |
tagttggtttgatttcttagatgcctagccacgtatgatgtgtttat |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43557207 |
tagttggtttgatttcttagatgcctagccacgtatgatgtatttat |
43557161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1973 times since January 2019
Visitors: 1435