View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_low_49 (Length: 270)
Name: NF0134_2D_low_49
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0134_2D_low_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 11681109 - 11680861
Alignment:
Q |
1 |
atgcgaaataagccaatagcctttttccaatttcttttaaggacaccatccaacaaatactcagtttgaatcaatgagttcagtggtgtgatgagattga |
100 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11681109 |
atgccaaataagccaatagcctttttccaatttcttttaaggacaccatccaacaaatactcagtttgaatcaatgagttcagtggtgtgatgagattga |
11681010 |
T |
 |
Q |
101 |
cccttaactaagagaatcatttcgcccacaataaggcagtaaccggctagtgcaggaaaaggtgaagggcagtctcctctccattggttcaaaaaacaca |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11681009 |
cccttaactaagagaatcatttcgcccacaataaggcagtaaccggctagtgcaggaaaaggtgaagggcagtctcctctccattggttcaaaaaacaca |
11680910 |
T |
 |
Q |
201 |
ttcaactgcaacctcaagatcgaaacaaataaacgtttatccctgccat |
249 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11680909 |
ttcatctgcaacctcaagatcgaaacaaataaacgtttatccctgccat |
11680861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University