View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_low_53 (Length: 263)
Name: NF0134_2D_low_53
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_2D_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 5 - 251
Target Start/End: Original strand, 35621587 - 35621833
Alignment:
| Q |
5 |
cagaacccacatgttagtcaaatccatttcactcttcactccactttcgcattctcttcaggttagttaccctctatttcaatttatattcttcttcgct |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35621587 |
cagaacccacatgttagtcaaatccatttcactcttcactccattttcgcattctcttcaggttagttaccctccatttcaatttatattcttcttcgct |
35621686 |
T |
|
| Q |
105 |
tgaattgttctgctgtgttccatttttgcataattttatgaagtgggcatggattgaattgtgtttagagtcttttgagcatgtaaaggttataacttta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35621687 |
tgaattgttctgctgtgttccatttttgcataattttatgaagtgggcatggattgaattgtgtttagagtcttttgagcatgtaaaggttataacttta |
35621786 |
T |
|
| Q |
205 |
ttttcatagttcattttctttatgtgggtcaagtcctttttgttgat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35621787 |
ttttcatagttcattttctttatgtgggtcaagtcctttttgttgat |
35621833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1957 times since January 2019
Visitors: 1435