View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_low_58 (Length: 258)
Name: NF0134_2D_low_58
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_2D_low_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 11717699 - 11717454
Alignment:
| Q |
1 |
atgttttaacatgccatcctatatataaagcataaaattaagttagagagttaaaaagtcacaagaccaaaggagaactcttaacaatggtttagaaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11717699 |
atgttttaacatgccatcctatatataaagcataaaattaagttagagagttaaaaagtcacaagaccaaaggaaaactcttaacaatggtttagaaatg |
11717600 |
T |
 |
| Q |
101 |
tataactggaaaatattatagaaattaaactctcacaatagctatattgtctaatgtttctgagtaaggttcagccaccagtgt--taggtggcttcatt |
198 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11717599 |
tataactggaaaatattaaaggaattaaactctcacaatagctatattgtctaatgtttctgagtaaggttcagccaccagtgttataggtggcttcatt |
11717500 |
T |
 |
| Q |
199 |
cgggggctaaactgggcgtatcagatgtttggtttgctatttgatg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11717499 |
cgggggctaaactgggcgtatcagatgtttggtttgctatttgatg |
11717454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University