View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_low_59 (Length: 257)
Name: NF0134_2D_low_59
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_2D_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 33178216 - 33178454
Alignment:
| Q |
1 |
tacaaaacgaggttatagtgacaaccgaatcttttgtttgaataataatataagtgattgtgcaaattaaaagatctatttcagatttgtggatggagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33178216 |
tacaaaacgaggttatagtgacaaccgaatcttttgtttgaataataatataagtgattgtgcaaattaaaagatctatttcagatttgtggatggagga |
33178315 |
T |
 |
| Q |
101 |
acataaaataagttaaggnnnnnnnnnnnacaaggaataagttatggttattctgcaccacttttactttaatccctttcttactctccacacttaccgt |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||| ||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
33178316 |
acataaaataagttaaggttttttattttacaaggaataagttaaggttattctgcacaactttcactttaatccgtttcttactctccacacttaccgt |
33178415 |
T |
 |
| Q |
201 |
accatgatgatgtgtatctccattattacaggagttacc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33178416 |
accatgatgatgtgtatctccattattacaggagttacc |
33178454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 198 - 238
Target Start/End: Original strand, 33185319 - 33185359
Alignment:
| Q |
198 |
cgtaccatgatgatgtgtatctccattattacaggagttac |
238 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
33185319 |
cgtaccatgataatgtgtatctccattattacaggcgttac |
33185359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University