View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_low_68 (Length: 227)
Name: NF0134_2D_low_68
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0134_2D_low_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 26412561 - 26412405
Alignment:
Q |
1 |
tagacgaacaggtgggttttctaatatgtctggaattatagcgaacagaaaagtgaaaactgcaagaagtaacaaaattctcgtaggaaagagatgtttc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26412561 |
tagacgaacaggtgggttttctaatatgtctggaattatagcgaacagaaaagtgaaaactgcaagaagtaacaaaattctcgtaggaaagagatgtttc |
26412462 |
T |
 |
Q |
101 |
tccacggatgtcatcaccaaaatctgttatttccacaacaacaaaaacaatgagtac |
157 |
Q |
|
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
26412461 |
tccacggatgttatcaccaaaacctgttatttccacaacaacaaaaacaatgagtac |
26412405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 147 - 227
Target Start/End: Original strand, 26412321 - 26412401
Alignment:
Q |
147 |
acaatgagtactcggccggaacttactgcaagtgatcgtacaagttttaagtatatcactgacatgatatttaagctcttt |
227 |
Q |
|
|
||||||| ||||| ||||||||||||| | |||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
26412321 |
acaatgactactcagccggaacttactacgagtgatcgaacaagtttcaagtatatcactgacatgatatttaagctcttt |
26412401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1802 times since January 2019
Visitors: 1430