View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_low_70 (Length: 226)
Name: NF0134_2D_low_70
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_2D_low_70 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 26 - 142
Target Start/End: Original strand, 43188164 - 43188280
Alignment:
| Q |
26 |
tttttggtgattctttcatcagttagcgttcaataaaacatgttagcatcatttgttcctatttggaatccggatggatatagggatctagcttccattc |
125 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43188164 |
tttttggtgattctttcatcagttggcgttcaataaaacatgttagcatcatttgttcctatttggaatccggatggatatagggatctagcttccattc |
43188263 |
T |
 |
| Q |
126 |
caccacttctgaaatcc |
142 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43188264 |
caccacttctgaaatcc |
43188280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University