View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_low_79 (Length: 214)
Name: NF0134_2D_low_79
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0134_2D_low_79 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 128 - 194
Target Start/End: Original strand, 43558348 - 43558414
Alignment:
Q |
128 |
ctcatatatcaccaaataagtctccaattatgtgtaacaaaatggcagcaatcgattcaccctttga |
194 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43558348 |
ctcatatatcaccaaataagtctccaattatgtgtaacaaaatggcagcaatcgattcaccctttga |
43558414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 50 - 136
Target Start/End: Original strand, 43557494 - 43557580
Alignment:
Q |
50 |
cttagaagcctgaactgctaaaagctggagaagaccacaaattcatgtccacgctcnnnnnnnatcttttataagctactcatatat |
136 |
Q |
|
|
||||||||| |||||||||||||| ||||||| ||| ||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
T |
43557494 |
cttagaagcatgaactgctaaaagttggagaataccgcaaattcatatccacgctctttattgatcttttataagctactcatatat |
43557580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1886 times since January 2019
Visitors: 1433