View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_low_80 (Length: 214)
Name: NF0134_2D_low_80
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_2D_low_80 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 6 - 136
Target Start/End: Original strand, 3002552 - 3002682
Alignment:
| Q |
6 |
accttttgcatggtgattttttgtgtgctcaattatgacataatcctatcctgtttggcatagtatttgaaactctcaatcctttgtcagcgatggatgt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3002552 |
accttttgcatggtgattttttgtgtgctcaattatgacataatcctatcctgtttggcatagtatttgaaactctcaatcctttgtcagcgatggatgt |
3002651 |
T |
 |
| Q |
106 |
cgatggaatgagatatggttgcttgctggtg |
136 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |
|
|
| T |
3002652 |
cgatggaatgagagatggttgcttgctggtg |
3002682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University