View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0134_2D_low_83 (Length: 212)
Name: NF0134_2D_low_83
Description: NF0134_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0134_2D_low_83 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 52 - 157
Target Start/End: Original strand, 2353840 - 2353945
Alignment:
| Q |
52 |
attgctacatggtgttaggaatcgttcactttttaattcggtaattttgattaactgagctaaaaaggtctacctcatgtttatatatgtctgaccaaac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2353840 |
attgctacatggtgttaggaatcgttcactttttaattcggtaattttgattaactgagctaaaaaggtctacctcatgtttatatatgtctgaccaaac |
2353939 |
T |
 |
| Q |
152 |
tccaaa |
157 |
Q |
| |
|
|||||| |
|
|
| T |
2353940 |
tccaaa |
2353945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University