View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0135_low_2 (Length: 319)
Name: NF0135_low_2
Description: NF0135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0135_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 4761959 - 4762185
Alignment:
| Q |
1 |
catgtagaataaatctgatgtatttgcgctcagaggataaccaattatttcttttttcctgttaggttttgtgttatttgatctaaagtggttttgcata |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4761959 |
catgtataataaatctgatgtatttgcgcgcaaaggataaccgattatttcttttttcctgttaggttttgtgttatttgatctaaagtggttttgcata |
4762058 |
T |
|
| Q |
101 |
tatgtaattttaatggtttctaatttttggaagtgatggaa-ttttctgatgaatttgtgggatttgttttgtttataggtatgaaccagaaattggctc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4762059 |
aatgtaattttaatggtttctaatttttggaagtgatggaatttttctgatgaatttgtgggatttgttttgtttataggtatgaaccagaaattggctc |
4762158 |
T |
|
| Q |
200 |
tatgttttcttcatggaaatgatgatg |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4762159 |
tatgttttcttcatggaaatgatgatg |
4762185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1635 times since January 2019
Visitors: 1426