View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0144-INSERTION-2 (Length: 594)
Name: NF0144-INSERTION-2
Description: NF0144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0144-INSERTION-2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 8 - 238
Target Start/End: Complemental strand, 34095470 - 34095243
Alignment:
| Q |
8 |
agaaccaacaaaaggaacataaccagaaccaaccaaaacagtgttattattgttgttggtggtgttttcattcatcatcatttgttgttgaggaaactga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34095470 |
agaaccaacaaaaggaacataaccagaaccaaccaaaacagtgttattattgttgttggtggtgttttcattcatcatcatttgttgttgaggaaactga |
34095371 |
T |
|
| Q |
108 |
aatggcccagttggtgaaaatgcaccatacttcaaaacctgttgttgttgatgaggaagatcaaagtgttttttcatcaatgccgctatcctctgcttct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34095370 |
aatggcccagttggtgaaaatgcaccatacttcaaaacctgtt---gttgatgaggaagatcaaagtgttttttcatcaatgccgctatcctctgcttct |
34095274 |
T |
|
| Q |
208 |
ctaactgttcaactcctacacctcttagtgg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34095273 |
ctaactgttcaactcctacacctcttagtgg |
34095243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 143; E-Value: 8e-75
Query Start/End: Original strand, 311 - 498
Target Start/End: Complemental strand, 34095170 - 34094983
Alignment:
| Q |
311 |
aagtgaaaagagagaaagagaaaagtgttatgtggtgaaagtgttttgtgtgtttatatagnnnnnnngtgtgagggttttattttatgaaggaaaagga |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34095170 |
aagtgaaaagagagaaagagaaaagtgttatgtggtgaaagtgttttgtgtgtttatatagaaaaaa-gtgtgagggttttattttatgaaggaaaagga |
34095072 |
T |
|
| Q |
411 |
aaatcagaatgtgttggtgaaaattggtgaaaggacattttggtatatgtgtgtaatgcttttgg-ggggcttattggtttgggaaccc |
498 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||| |||| |
|
|
| T |
34095071 |
aaatcagaatgtgttggtgaaaattggtgaaaggacattttggtatatgtgtgtaatgcttttggagggtcttattgttttggggaccc |
34094983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 79 - 143
Target Start/End: Original strand, 12294560 - 12294624
Alignment:
| Q |
79 |
tcatcatcatttgttgttgaggaaactgaaatggcccagttggtgaaaatgcaccatacttcaaa |
143 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| | || ||| ||| |||||||||||| ||||| |
|
|
| T |
12294560 |
tcatcatcacttgttgttgaggaaactgaaatgacacatttgatgataatgcaccatacctcaaa |
12294624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1571 times since January 2019
Visitors: 1425