View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0144-INSERTION-3 (Length: 113)
Name: NF0144-INSERTION-3
Description: NF0144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0144-INSERTION-3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 9e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 9e-49
Query Start/End: Original strand, 7 - 104
Target Start/End: Complemental strand, 36886908 - 36886811
Alignment:
| Q |
7 |
acttctatctttagcactgtgtttttcttgtgattatttcaatgcagacagaatgcttgctttcttgtaactatttgagcaaaattattccgcacaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36886908 |
acttctatctttagcactgtgtttttcttgtgattatttcaatgcagacagaatgcttgctttcttgtaactatttgagcaaaattattccgcacaat |
36886811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1434 times since January 2019
Visitors: 1420