View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0144-INSERTION-6 (Length: 219)
Name: NF0144-INSERTION-6
Description: NF0144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0144-INSERTION-6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 13 - 214
Target Start/End: Original strand, 4970027 - 4970229
Alignment:
Q |
13 |
aatcccacattcttcacactttaaaa-gtatgtaatctaacccttaaactattttttnnnnnnnnnnnnntcatacgtaattgttttatttttacaaatc |
111 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||| ||| ||||||| || |||||| ||||||||||||||||||||||| |
|
|
T |
4970027 |
aatcccacattcttcacactttaaaaagtatgtaatctaaccattagactatttgttaaaaaagtaaaaatcatacataattgttttatttttacaaatc |
4970126 |
T |
 |
Q |
112 |
agcaagatatcatgagccataaaactcaagtctttatgtcaagcaactcgaaattacatcaattaatctagctagagctgttaaaacggggcggttcggc |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
T |
4970127 |
agcaagatatcatgagccataaaactcaagtctttatgtcaagcaacccgaaattacatcaattaatccagctagagctgtcaaaacggggcggttcggc |
4970226 |
T |
 |
Q |
212 |
ccg |
214 |
Q |
|
|
||| |
|
|
T |
4970227 |
ccg |
4970229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University