View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0147_low_4 (Length: 323)
Name: NF0147_low_4
Description: NF0147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0147_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 30 - 250
Target Start/End: Complemental strand, 31789935 - 31789714
Alignment:
| Q |
30 |
taatccccctccttcagatgcaattccatttattgacttccttggagtaggagccacatgatcaaagttataaactaatcaaaaagctgcaatgcaaccc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789935 |
taatccccctccttcagatgcaattccatttattgacttccttggagtaggagccacatgatcaaagttataaactaatcaaaaagctgcaatgcaaccc |
31789836 |
T |
|
| Q |
130 |
nnnnnnnnc-ccattgaagctcctcaatataggtgtggtccaacattacctaaaaaccattcgaggtaaacagaaaggatagttgctctactttggtcac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789835 |
ttttttttttccattgaagctcctcaatataggtgtggtccaacattacctaaaaaccattcgaggtaaacagaaaggatagttgctctactttggtcac |
31789736 |
T |
|
| Q |
229 |
tgtgttacttgcgtcatctctg |
250 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
31789735 |
tgtgttacttgcgtcatttctg |
31789714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1332 times since January 2019
Visitors: 1417