View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0147_low_6 (Length: 220)

Name: NF0147_low_6
Description: NF0147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0147_low_6
NF0147_low_6
[»] chr7 (1 HSPs)
chr7 (1-133)||(48167557-48167689)


Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 48167557 - 48167689
Alignment:
1 tgcacttaattgggaatgattagaaaatgttttcttaatgccttgtattgattttattgtttagcttacaaacattcttttgactgagaaatatgaagcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48167557 tgcacttaattgggaatgattagaaaatgttttcttaatgccttgtattgattttattgtttagcttacaaacattcttttgactgagaaatatgaagcc 48167656  T
101 aaactgtcggattttggattgtcaaggatgatg 133  Q
    |||||||||||||||||||||||||||||||||    
48167657 aaactgtcggattttggattgtcaaggatgatg 48167689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University