View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0147_low_6 (Length: 220)
Name: NF0147_low_6
Description: NF0147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0147_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 48167557 - 48167689
Alignment:
| Q |
1 |
tgcacttaattgggaatgattagaaaatgttttcttaatgccttgtattgattttattgtttagcttacaaacattcttttgactgagaaatatgaagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48167557 |
tgcacttaattgggaatgattagaaaatgttttcttaatgccttgtattgattttattgtttagcttacaaacattcttttgactgagaaatatgaagcc |
48167656 |
T |
|
| Q |
101 |
aaactgtcggattttggattgtcaaggatgatg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48167657 |
aaactgtcggattttggattgtcaaggatgatg |
48167689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1308 times since January 2019
Visitors: 1417