View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0150-INSERTION-10 (Length: 482)

Name: NF0150-INSERTION-10
Description: NF0150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0150-INSERTION-10
NF0150-INSERTION-10
[»] chr8 (100 HSPs)
chr8 (338-480)||(22510138-22510280)
chr8 (101-228)||(22510018-22510145)
chr8 (8-100)||(39052954-39053046)
chr8 (8-100)||(24532446-24532538)
chr8 (8-100)||(35682806-35682898)
chr8 (8-101)||(17469784-17469877)
chr8 (8-100)||(11232219-11232311)
chr8 (8-100)||(17477032-17477124)
chr8 (8-100)||(19256611-19256703)
chr8 (14-100)||(5931980-5932066)
chr8 (14-100)||(41790626-41790712)
chr8 (8-100)||(3157584-3157677)
chr8 (8-101)||(11232454-11232547)
chr8 (8-101)||(19256845-19256938)
chr8 (8-89)||(38447452-38447533)
chr8 (27-100)||(39052581-39052654)
chr8 (8-100)||(39960158-39960251)
chr8 (8-100)||(24075331-24075423)
chr8 (7-101)||(25325612-25325706)
chr8 (14-100)||(31197814-31197900)
chr8 (15-100)||(5590400-5590485)
chr8 (8-101)||(36917464-36917557)
chr8 (8-96)||(4828264-4828352)
chr8 (16-96)||(7729912-7729992)
chr8 (16-100)||(10449967-10450051)
chr8 (8-100)||(34842645-34842737)
chr8 (8-100)||(39743496-39743588)
chr8 (8-87)||(8928997-8929076)
chr8 (8-102)||(42846630-42846725)
chr8 (14-100)||(422248-422334)
chr8 (18-96)||(29907761-29907839)
chr8 (8-97)||(12688277-12688366)
chr8 (15-100)||(18004128-18004213)
chr8 (15-100)||(20301228-20301313)
chr8 (15-100)||(21087860-21087945)
chr8 (27-100)||(28069401-28069474)
chr8 (8-100)||(15042695-15042787)
chr8 (8-100)||(34843084-34843176)
chr8 (14-73)||(7669635-7669694)
chr8 (30-100)||(12317013-12317083)
chr8 (8-74)||(37001219-37001285)
chr8 (8-89)||(5932209-5932290)
chr8 (16-101)||(7267498-7267583)
chr8 (27-100)||(20094604-20094677)
chr8 (27-96)||(34236692-34236761)
chr8 (8-100)||(35385836-35385929)
chr8 (8-96)||(4828039-4828127)
chr8 (14-74)||(20515137-20515197)
chr8 (8-88)||(22638204-22638284)
chr8 (16-100)||(31197582-31197666)
chr8 (8-88)||(37001443-37001523)
chr8 (26-100)||(3157051-3157126)
chr8 (14-72)||(10884059-10884118)
chr8 (7-74)||(20094818-20094885)
chr8 (8-99)||(39984782-39984873)
chr8 (13-74)||(20301494-20301555)
chr8 (13-74)||(21088126-21088187)
chr8 (14-87)||(37868379-37868452)
chr8 (8-100)||(12547066-12547157)
chr8 (8-88)||(16050008-16050088)
chr8 (8-100)||(3157352-3157441)
chr8 (8-95)||(26800537-26800624)
chr8 (15-100)||(20702763-20702849)
chr8 (8-74)||(27439572-27439638)
chr8 (14-96)||(30201555-30201637)
chr8 (14-96)||(37868614-37868696)
chr8 (15-88)||(4873723-4873795)
chr8 (8-89)||(8084105-8084186)
chr8 (14-87)||(28213352-28213425)
chr8 (59-100)||(39052770-39052811)
chr8 (16-100)||(4873490-4873574)
chr8 (8-96)||(5675759-5675847)
chr8 (8-100)||(16050228-16050319)
chr8 (16-60)||(38475754-38475798)
chr8 (14-62)||(40014663-40014711)
chr8 (16-96)||(44931215-44931295)
chr8 (15-62)||(42049719-42049766)
chr8 (26-96)||(5940029-5940099)
chr8 (14-68)||(12688071-12688125)
chr8 (8-74)||(38476270-38476336)
chr8 (14-75)||(37868103-37868164)
chr8 (15-59)||(6559481-6559525)
chr8 (8-56)||(27204975-27205023)
chr8 (8-56)||(27205073-27205121)
chr8 (8-56)||(27205171-27205219)
chr8 (27-99)||(29099784-29099856)
chr8 (16-64)||(30966100-30966148)
chr8 (52-100)||(44354023-44354070)
chr8 (14-69)||(42584672-42584727)
chr8 (27-89)||(8466532-8466594)
chr8 (8-66)||(15042911-15042969)
chr8 (26-100)||(28213147-28213220)
chr8 (14-60)||(37867863-37867909)
chr8 (27-100)||(8084329-8084402)
chr8 (8-85)||(8716096-8716173)
chr8 (26-59)||(18939340-18939373)
chr8 (8-60)||(8466749-8466801)
chr8 (14-62)||(10615635-10615683)
chr8 (26-62)||(31079605-31079641)
chr8 (52-100)||(44356523-44356570)
[»] chr2 (81 HSPs)
chr2 (8-103)||(40379469-40379564)
chr2 (15-100)||(94052-94137)
chr2 (16-100)||(17719367-17719451)
chr2 (8-100)||(40379234-40379326)
chr2 (8-100)||(16419469-16419561)
chr2 (7-100)||(2029736-2029829)
chr2 (15-100)||(16533514-16533599)
chr2 (8-100)||(5711464-5711556)
chr2 (8-100)||(32884074-32884166)
chr2 (16-100)||(37812301-37812385)
chr2 (14-100)||(33606085-33606171)
chr2 (8-101)||(14466435-14466528)
chr2 (16-100)||(93156-93239)
chr2 (8-100)||(2324207-2324299)
chr2 (8-100)||(2324441-2324533)
chr2 (16-100)||(37812531-37812615)
chr2 (8-100)||(37840304-37840396)
chr2 (14-100)||(17525369-17525455)
chr2 (7-100)||(2029971-2030064)
chr2 (8-101)||(28407818-28407911)
chr2 (8-100)||(5711700-5711792)
chr2 (8-100)||(12343775-12343867)
chr2 (16-100)||(15518727-15518811)
chr2 (8-100)||(27897631-27897722)
chr2 (8-100)||(29718295-29718387)
chr2 (17-100)||(4662198-4662281)
chr2 (14-100)||(31700776-31700865)
chr2 (14-100)||(17854723-17854809)
chr2 (8-100)||(17854954-17855046)
chr2 (8-100)||(19191635-19191727)
chr2 (14-100)||(5509280-5509366)
chr2 (8-94)||(24395837-24395922)
chr2 (15-88)||(14927081-14927154)
chr2 (8-101)||(37769968-37770061)
chr2 (15-100)||(40149260-40149343)
chr2 (14-101)||(5851713-5851803)
chr2 (8-100)||(15124573-15124665)
chr2 (16-88)||(18607042-18607114)
chr2 (8-100)||(24396067-24396159)
chr2 (8-100)||(40149028-40149120)
chr2 (8-98)||(5509048-5509138)
chr2 (21-87)||(44404196-44404262)
chr2 (8-72)||(14927288-14927352)
chr2 (8-100)||(15464736-15464828)
chr2 (8-100)||(25082562-25082654)
chr2 (8-100)||(32356353-32356444)
chr2 (26-85)||(9927893-9927952)
chr2 (9-100)||(35418440-35418531)
chr2 (18-100)||(3738900-3738982)
chr2 (27-100)||(13486300-13486374)
chr2 (38-100)||(27036467-27036529)
chr2 (14-100)||(36316082-36316168)
chr2 (26-100)||(36351969-36352043)
chr2 (43-100)||(14466235-14466292)
chr2 (8-100)||(21591748-21591841)
chr2 (8-65)||(36352184-36352241)
chr2 (27-100)||(44403970-44404043)
chr2 (26-78)||(11020547-11020599)
chr2 (14-62)||(19571005-19571053)
chr2 (8-100)||(40718232-40718324)
chr2 (8-100)||(42639639-42639731)
chr2 (14-69)||(19544402-19544456)
chr2 (27-82)||(24666276-24666331)
chr2 (14-88)||(38629820-38629894)
chr2 (15-56)||(93479-93520)
chr2 (15-56)||(93752-93793)
chr2 (16-49)||(10585001-10585034)
chr2 (14-63)||(33606320-33606369)
chr2 (8-100)||(8424855-8424947)
chr2 (9-96)||(10523224-10523311)
chr2 (8-67)||(15124808-15124867)
chr2 (15-62)||(15988218-15988265)
chr2 (16-66)||(1926474-1926524)
chr2 (14-56)||(15988423-15988465)
chr2 (14-88)||(17525130-17525204)
chr2 (8-58)||(17719575-17719625)
chr2 (39-100)||(25313569-25313631)
chr2 (14-59)||(13210534-13210579)
chr2 (32-64)||(4431657-4431689)
chr2 (16-60)||(8227356-8227400)
chr2 (27-71)||(13296398-13296442)
[»] chr4 (97 HSPs)
chr4 (8-101)||(50543592-50543685)
chr4 (8-100)||(28245551-28245643)
chr4 (8-104)||(9279190-9279286)
chr4 (8-100)||(53814954-53815046)
chr4 (15-100)||(31254439-31254524)
chr4 (8-100)||(11036771-11036863)
chr4 (8-100)||(39902588-39902680)
chr4 (16-102)||(27634549-27634635)
chr4 (15-100)||(35796774-35796859)
chr4 (8-100)||(21498762-21498854)
chr4 (8-100)||(22231098-22231190)
chr4 (16-96)||(22827509-22827589)
chr4 (8-100)||(35788626-35788718)
chr4 (8-100)||(35788861-35788953)
chr4 (8-100)||(50543355-50543447)
chr4 (14-100)||(21498321-21498407)
chr4 (26-100)||(35645808-35645882)
chr4 (8-102)||(53828548-53828642)
chr4 (8-101)||(22845472-22845565)
chr4 (8-101)||(22863440-22863533)
chr4 (27-100)||(27634125-27634198)
chr4 (16-100)||(13555500-13555584)
chr4 (8-96)||(44118884-44118972)
chr4 (14-100)||(20821940-20822026)
chr4 (15-100)||(35819160-35819245)
chr4 (16-100)||(5846346-5846430)
chr4 (8-100)||(35609515-35609607)
chr4 (8-100)||(40717466-40717558)
chr4 (15-100)||(400597-400682)
chr4 (15-100)||(9685365-9685450)
chr4 (8-101)||(21684964-21685057)
chr4 (8-100)||(1518131-1518223)
chr4 (8-100)||(5398501-5398592)
chr4 (8-88)||(6218183-6218263)
chr4 (8-100)||(11036536-11036628)
chr4 (8-100)||(25052819-25052911)
chr4 (8-96)||(27464273-27464361)
chr4 (8-100)||(53828314-53828406)
chr4 (9-100)||(5846113-5846204)
chr4 (8-67)||(28246110-28246169)
chr4 (18-100)||(6218406-6218488)
chr4 (8-98)||(37836049-37836139)
chr4 (8-69)||(52559565-52559626)
chr4 (8-100)||(9685599-9685691)
chr4 (8-72)||(12869054-12869118)
chr4 (17-97)||(13611783-13611863)
chr4 (8-100)||(22231333-22231425)
chr4 (8-100)||(35797002-35797094)
chr4 (8-103)||(14783212-14783307)
chr4 (45-100)||(17111735-17111790)
chr4 (26-100)||(980093-980167)
chr4 (15-89)||(7806613-7806687)
chr4 (16-98)||(35175004-35175086)
chr4 (26-100)||(45784921-45784995)
chr4 (10-100)||(54055060-54055149)
chr4 (8-88)||(26549615-26549696)
chr4 (16-89)||(52559782-52559855)
chr4 (16-88)||(2221001-2221073)
chr4 (8-100)||(5398237-5398328)
chr4 (28-100)||(13555292-13555364)
chr4 (8-70)||(2463803-2463865)
chr4 (14-96)||(7926299-7926381)
chr4 (14-72)||(53814705-53814763)
chr4 (16-100)||(6778694-6778779)
chr4 (8-93)||(13637363-13637448)
chr4 (27-72)||(16066060-16066105)
chr4 (8-69)||(34358055-34358116)
chr4 (8-69)||(36685900-36685961)
chr4 (16-100)||(18528250-18528334)
chr4 (8-60)||(35609736-35609788)
chr4 (8-100)||(54054830-54054922)
chr4 (16-58)||(17222685-17222727)
chr4 (15-101)||(18528489-18528575)
chr4 (8-73)||(12869288-12869353)
chr4 (14-59)||(25715901-25715946)
chr4 (9-74)||(41187958-41188023)
chr4 (15-59)||(12005501-12005545)
chr4 (8-60)||(25323823-25323875)
chr4 (8-60)||(25324058-25324110)
chr4 (32-100)||(40717255-40717323)
chr4 (15-62)||(9908863-9908910)
chr4 (9-60)||(42684819-42684870)
chr4 (8-102)||(11783817-11783911)
chr4 (8-62)||(21646290-21646344)
chr4 (18-68)||(21646536-21646586)
chr4 (14-88)||(21750073-21750147)
chr4 (14-100)||(42662430-42662516)
chr4 (8-46)||(52146090-52146128)
chr4 (27-100)||(11103940-11104013)
chr4 (8-73)||(35485221-35485286)
chr4 (27-68)||(53699026-53699067)
chr4 (28-72)||(2261798-2261842)
chr4 (8-60)||(6666225-6666277)
chr4 (32-100)||(17111531-17111598)
chr4 (18-62)||(20726859-20726903)
chr4 (8-48)||(22445471-22445511)
chr4 (19-55)||(24513395-24513431)
[»] chr3 (85 HSPs)
chr3 (8-100)||(35038219-35038311)
chr3 (8-100)||(35038453-35038545)
chr3 (8-100)||(20327639-20327731)
chr3 (8-100)||(20327874-20327966)
chr3 (14-100)||(16239558-16239644)
chr3 (8-101)||(54567858-54567951)
chr3 (8-100)||(11589752-11589844)
chr3 (8-100)||(16926974-16927066)
chr3 (8-100)||(54368483-54368575)
chr3 (14-100)||(39683298-39683385)
chr3 (14-88)||(50083112-50083186)
chr3 (15-100)||(22729067-22729152)
chr3 (15-100)||(23691224-23691309)
chr3 (15-100)||(23708024-23708109)
chr3 (15-100)||(23726480-23726565)
chr3 (15-100)||(23744936-23745021)
chr3 (15-100)||(24063461-24063546)
chr3 (8-101)||(38791475-38791568)
chr3 (8-89)||(45138827-45138908)
chr3 (8-100)||(1723101-1723192)
chr3 (14-100)||(20303095-20303181)
chr3 (7-100)||(6487357-6487450)
chr3 (20-85)||(30138046-30138111)
chr3 (20-85)||(30147597-30147662)
chr3 (8-89)||(45138996-45139077)
chr3 (8-100)||(4155291-4155383)
chr3 (8-100)||(8018935-8019027)
chr3 (8-100)||(16239794-16239886)
chr3 (8-100)||(17638202-17638293)
chr3 (16-96)||(30179741-30179821)
chr3 (8-100)||(39620293-39620385)
chr3 (8-100)||(49629573-49629664)
chr3 (8-79)||(472085-472156)
chr3 (41-100)||(34992517-34992576)
chr3 (17-100)||(39269298-39269381)
chr3 (18-100)||(4155526-4155608)
chr3 (16-98)||(21809180-21809262)
chr3 (8-89)||(18757820-18757901)
chr3 (15-100)||(23708256-23708341)
chr3 (15-100)||(23726712-23726797)
chr3 (15-100)||(23745168-23745253)
chr3 (8-72)||(34610555-34610620)
chr3 (8-100)||(7697423-7697514)
chr3 (8-100)||(9272928-9273020)
chr3 (8-100)||(9273162-9273254)
chr3 (8-88)||(12930153-12930233)
chr3 (16-100)||(14839770-14839854)
chr3 (26-98)||(54368691-54368763)
chr3 (14-100)||(31317196-31317281)
chr3 (15-68)||(24063693-24063746)
chr3 (8-100)||(27086554-27086649)
chr3 (8-100)||(27670417-27670509)
chr3 (13-100)||(17638375-17638461)
chr3 (8-74)||(1800208-1800274)
chr3 (14-100)||(3975389-3975475)
chr3 (14-100)||(17001452-17001538)
chr3 (16-74)||(43781576-43781634)
chr3 (8-62)||(50930707-50930761)
chr3 (15-68)||(23691456-23691509)
chr3 (8-100)||(31317433-31317525)
chr3 (8-96)||(45828217-45828305)
chr3 (14-87)||(2805342-2805416)
chr3 (8-62)||(13574946-13575000)
chr3 (8-74)||(33205458-33205524)
chr3 (8-73)||(50052564-50052630)
chr3 (31-100)||(4008652-4008721)
chr3 (8-80)||(13741126-13741199)
chr3 (14-100)||(28087246-28087336)
chr3 (52-100)||(34992808-34992857)
chr3 (24-100)||(2123774-2123850)
chr3 (15-59)||(45828027-45828071)
chr3 (18-73)||(50052800-50052856)
chr3 (15-74)||(20479001-20479060)
chr3 (19-98)||(29575926-29576005)
chr3 (27-62)||(41915176-41915211)
chr3 (16-62)||(14991878-14991924)
chr3 (15-73)||(17001274-17001332)
chr3 (8-49)||(14611194-14611235)
chr3 (59-100)||(20303013-20303054)
chr3 (8-45)||(24866219-24866256)
chr3 (27-68)||(33640280-33640321)
chr3 (14-55)||(46794246-46794287)
chr3 (14-62)||(2806317-2806365)
chr3 (8-60)||(23610396-23610448)
chr3 (16-100)||(52724019-52724103)
[»] chr7 (97 HSPs)
chr7 (8-100)||(21054978-21055070)
chr7 (8-101)||(47710409-47710502)
chr7 (8-101)||(47722065-47722158)
chr7 (8-101)||(29469571-29469664)
chr7 (8-100)||(2544472-2544564)
chr7 (8-100)||(21861496-21861588)
chr7 (8-100)||(26239941-26240033)
chr7 (8-100)||(29469807-29469899)
chr7 (8-100)||(48243086-48243176)
chr7 (15-100)||(48661587-48661672)
chr7 (8-100)||(3392949-3393041)
chr7 (16-100)||(9689123-9689207)
chr7 (8-100)||(34027360-34027452)
chr7 (8-100)||(36277251-36277343)
chr7 (8-100)||(48243462-48243554)
chr7 (14-101)||(21861260-21861347)
chr7 (18-100)||(2404209-2404291)
chr7 (34-100)||(3519776-3519842)
chr7 (18-88)||(3520075-3520145)
chr7 (8-98)||(33996336-33996426)
chr7 (15-100)||(42985155-42985240)
chr7 (19-100)||(43688195-43688276)
chr7 (18-100)||(2404443-2404525)
chr7 (14-100)||(26562104-26562190)
chr7 (8-102)||(36206088-36206182)
chr7 (19-100)||(1596561-1596642)
chr7 (8-69)||(25620134-25620195)
chr7 (27-100)||(31485468-31485541)
chr7 (8-100)||(46452599-46452692)
chr7 (16-100)||(1596795-1596879)
chr7 (8-100)||(3038109-3038201)
chr7 (8-100)||(17202146-17202238)
chr7 (8-100)||(34027594-34027686)
chr7 (27-99)||(44874390-44874462)
chr7 (15-82)||(31485691-31485758)
chr7 (30-100)||(6001482-6001552)
chr7 (14-100)||(22574572-22574658)
chr7 (14-100)||(31892118-31892204)
chr7 (15-89)||(32278917-32278991)
chr7 (8-100)||(2544240-2544332)
chr7 (8-100)||(6634822-6634914)
chr7 (17-97)||(9625383-9625463)
chr7 (8-96)||(11211704-11211791)
chr7 (8-100)||(18826513-18826605)
chr7 (16-88)||(35308179-35308251)
chr7 (8-100)||(36993099-36993191)
chr7 (8-102)||(10903049-10903144)
chr7 (8-74)||(32879639-32879706)
chr7 (8-67)||(43075335-43075394)
chr7 (8-67)||(43085562-43085621)
chr7 (8-67)||(43089233-43089292)
chr7 (30-100)||(4267821-4267891)
chr7 (18-100)||(4268021-4268103)
chr7 (16-74)||(4454769-4454827)
chr7 (14-72)||(10882036-10882094)
chr7 (8-89)||(2315295-2315376)
chr7 (26-99)||(33996122-33996195)
chr7 (15-100)||(40746465-40746550)
chr7 (28-100)||(9688915-9688987)
chr7 (14-99)||(33834394-33834471)
chr7 (8-74)||(15317546-15317611)
chr7 (26-100)||(22574803-22574876)
chr7 (14-100)||(28080632-28080717)
chr7 (14-96)||(47849542-47849624)
chr7 (15-88)||(23839109-23839182)
chr7 (8-89)||(40746243-40746324)
chr7 (15-100)||(41190981-41191066)
chr7 (16-100)||(25620338-25620422)
chr7 (8-67)||(4506932-4506991)
chr7 (21-100)||(5522846-5522925)
chr7 (8-87)||(23796209-23796288)
chr7 (19-73)||(4886323-4886377)
chr7 (8-74)||(8075852-8075918)
chr7 (8-98)||(31257056-31257146)
chr7 (14-100)||(31892354-31892440)
chr7 (14-100)||(40746064-40746150)
chr7 (8-88)||(1793727-1793805)
chr7 (15-96)||(2401331-2401412)
chr7 (8-56)||(1000560-1000608)
chr7 (8-56)||(14540977-14541025)
chr7 (27-63)||(20305707-20305743)
chr7 (15-99)||(26028993-26029077)
chr7 (16-60)||(30727151-30727195)
chr7 (8-88)||(31257292-31257372)
chr7 (26-89)||(32292719-32292782)
chr7 (14-50)||(32474517-32474553)
chr7 (26-88)||(14540784-14540846)
chr7 (8-62)||(21213066-21213120)
chr7 (14-88)||(21821785-21821859)
chr7 (16-62)||(24432083-24432128)
chr7 (16-78)||(32279099-32279161)
chr7 (26-68)||(36277034-36277076)
chr7 (8-62)||(40898740-40898794)
chr7 (26-100)||(21822006-21822084)
chr7 (8-73)||(32292513-32292578)
chr7 (26-62)||(40898965-40899001)
chr7 (8-60)||(47849797-47849849)
[»] chr1 (90 HSPs)
chr1 (15-100)||(25145517-25145602)
chr1 (8-100)||(25713360-25713452)
chr1 (8-100)||(35772231-35772323)
chr1 (15-97)||(2859424-2859506)
chr1 (8-102)||(4113031-4113125)
chr1 (8-100)||(52650796-52650888)
chr1 (8-87)||(40079132-40079211)
chr1 (15-101)||(2859659-2859745)
chr1 (14-100)||(16163134-16163220)
chr1 (14-100)||(38668327-38668413)
chr1 (15-100)||(855948-856033)
chr1 (8-100)||(15986358-15986450)
chr1 (8-100)||(17452853-17452945)
chr1 (8-100)||(25145745-25145837)
chr1 (32-100)||(51459879-51459947)
chr1 (25-100)||(8870731-8870806)
chr1 (8-103)||(38080569-38080663)
chr1 (18-100)||(27413549-27413631)
chr1 (8-100)||(3169733-3169825)
chr1 (8-100)||(51588959-51589051)
chr1 (8-100)||(51589193-51589285)
chr1 (8-100)||(52961549-52961641)
chr1 (30-101)||(20208573-20208644)
chr1 (14-100)||(41035858-41035944)
chr1 (8-73)||(17452704-17452769)
chr1 (8-101)||(26176874-26176967)
chr1 (15-100)||(38733119-38733203)
chr1 (15-100)||(38733349-38733434)
chr1 (8-100)||(30369802-30369894)
chr1 (8-96)||(31181538-31181626)
chr1 (8-88)||(39348377-39348457)
chr1 (8-99)||(25137328-25137419)
chr1 (14-100)||(51459736-51459822)
chr1 (15-100)||(11924888-11924973)
chr1 (8-101)||(26173481-26173574)
chr1 (7-100)||(28408066-28408159)
chr1 (32-100)||(51460130-51460199)
chr1 (8-100)||(12244987-12245079)
chr1 (8-100)||(26177110-26177202)
chr1 (8-100)||(26865383-26865475)
chr1 (8-96)||(39348144-39348232)
chr1 (8-100)||(42586464-42586555)
chr1 (18-100)||(4112805-4112888)
chr1 (8-103)||(16162897-16162992)
chr1 (14-100)||(4098433-4098519)
chr1 (26-100)||(4112583-4112657)
chr1 (14-96)||(17468315-17468397)
chr1 (14-68)||(26173255-26173309)
chr1 (14-100)||(35892258-35892344)
chr1 (33-99)||(39808434-39808500)
chr1 (8-100)||(3169967-3170060)
chr1 (19-100)||(17402549-17402630)
chr1 (16-100)||(7307688-7307772)
chr1 (33-101)||(13386214-13386282)
chr1 (52-100)||(33156936-33156984)
chr1 (16-99)||(369603-369686)
chr1 (14-96)||(21626370-21626452)
chr1 (8-62)||(52907389-52907443)
chr1 (8-101)||(43409773-43409865)
chr1 (20-96)||(7826068-7826144)
chr1 (8-100)||(38668092-38668184)
chr1 (32-100)||(51460256-51460324)
chr1 (8-68)||(51589805-51589865)
chr1 (30-73)||(17402708-17402751)
chr1 (16-62)||(12376470-12376516)
chr1 (16-62)||(31004470-31004516)
chr1 (8-74)||(32223756-32223822)
chr1 (18-100)||(32952038-32952120)
chr1 (8-62)||(42351885-42351939)
chr1 (15-100)||(4098195-4098280)
chr1 (19-60)||(7465681-7465722)
chr1 (8-89)||(9499224-9499304)
chr1 (14-87)||(40524682-40524755)
chr1 (8-68)||(8870935-8870995)
chr1 (18-62)||(12325331-12325375)
chr1 (31-99)||(17412304-17412372)
chr1 (8-68)||(26346993-26347053)
chr1 (8-48)||(31432255-31432295)
chr1 (8-100)||(52127688-52127779)
chr1 (30-89)||(3477223-3477282)
chr1 (15-62)||(40316082-40316129)
chr1 (14-100)||(51590007-51590091)
chr1 (15-57)||(22377542-22377584)
chr1 (15-100)||(17412534-17412619)
chr1 (15-100)||(27413314-27413399)
chr1 (16-81)||(34264743-34264808)
chr1 (23-68)||(49142507-49142552)
chr1 (15-63)||(5109488-5109536)
chr1 (52-100)||(33156405-33156453)
chr1 (26-62)||(49142958-49142994)
[»] chr6 (75 HSPs)
chr6 (8-100)||(4868602-4868694)
chr6 (8-98)||(13740885-13740975)
chr6 (8-98)||(13746385-13746475)
chr6 (15-100)||(3680213-3680298)
chr6 (8-101)||(6542968-6543061)
chr6 (8-101)||(9704986-9705079)
chr6 (8-101)||(13353167-13353260)
chr6 (8-100)||(4868838-4868930)
chr6 (8-100)||(9705221-9705313)
chr6 (8-100)||(33494506-33494598)
chr6 (8-100)||(33796293-33796385)
chr6 (14-101)||(27653183-27653270)
chr6 (14-100)||(17147691-17147777)
chr6 (14-100)||(19712919-19713005)
chr6 (8-98)||(30256782-30256871)
chr6 (8-101)||(27772680-27772773)
chr6 (16-100)||(2736435-2736519)
chr6 (16-100)||(2737203-2737287)
chr6 (8-100)||(2753225-2753317)
chr6 (8-100)||(24554084-24554176)
chr6 (8-100)||(27656425-27656517)
chr6 (8-98)||(25065119-25065209)
chr6 (14-100)||(27772913-27772999)
chr6 (27-100)||(31961145-31961218)
chr6 (8-100)||(6400645-6400737)
chr6 (8-100)||(8026356-8026448)
chr6 (8-100)||(8566984-8567075)
chr6 (8-100)||(21690689-21690781)
chr6 (14-100)||(6400877-6400963)
chr6 (8-97)||(12199830-12199919)
chr6 (15-100)||(12330323-12330407)
chr6 (8-100)||(15600903-15600995)
chr6 (8-100)||(28867982-28868074)
chr6 (21-100)||(6237740-6237819)
chr6 (7-100)||(7915817-7915911)
chr6 (15-85)||(12330211-12330281)
chr6 (8-94)||(16722832-16722918)
chr6 (8-100)||(3679979-3680071)
chr6 (8-88)||(5572409-5572489)
chr6 (16-88)||(15102964-15103036)
chr6 (8-100)||(21214952-21215044)
chr6 (32-103)||(6369428-6369499)
chr6 (30-100)||(2736214-2736284)
chr6 (26-100)||(4906773-4906847)
chr6 (14-100)||(15081939-15082025)
chr6 (14-100)||(19639144-19639230)
chr6 (27-100)||(6054370-6054443)
chr6 (15-88)||(11085560-11085633)
chr6 (9-86)||(33631831-33631907)
chr6 (8-100)||(6065942-6066034)
chr6 (8-96)||(16570130-16570218)
chr6 (8-59)||(19712722-19712773)
chr6 (26-100)||(12329987-12330061)
chr6 (19-100)||(5572651-5572732)
chr6 (27-100)||(7638634-7638707)
chr6 (8-65)||(11721907-11721964)
chr6 (8-100)||(33494741-33494834)
chr6 (16-100)||(6542742-6542825)
chr6 (16-87)||(3713322-3713393)
chr6 (8-67)||(30256578-30256637)
chr6 (15-73)||(13740675-13740733)
chr6 (15-73)||(13746175-13746233)
chr6 (8-49)||(8026622-8026663)
chr6 (16-100)||(30505470-30505558)
chr6 (16-100)||(30505704-30505789)
chr6 (52-100)||(13353403-13353451)
chr6 (52-100)||(33796528-33796576)
chr6 (26-69)||(12199728-12199771)
chr6 (18-88)||(3713009-3713079)
chr6 (8-50)||(6623435-6623477)
chr6 (14-99)||(15082175-15082259)
chr6 (8-97)||(30849427-30849516)
chr6 (17-69)||(467609-467661)
chr6 (26-70)||(1788780-1788824)
chr6 (28-88)||(11085792-11085852)
[»] chr5 (98 HSPs)
chr5 (8-100)||(24647663-24647755)
chr5 (8-100)||(41666782-41666874)
chr5 (8-100)||(41667018-41667110)
chr5 (8-100)||(95291-95383)
chr5 (14-94)||(15480295-15480375)
chr5 (8-100)||(18333490-18333582)
chr5 (8-100)||(24346526-24346618)
chr5 (8-100)||(8081138-8081231)
chr5 (8-101)||(9368561-9368654)
chr5 (8-100)||(2063759-2063850)
chr5 (8-100)||(20510667-20510759)
chr5 (27-100)||(33337282-33337355)
chr5 (8-100)||(8098285-8098376)
chr5 (8-100)||(19705870-19705962)
chr5 (8-100)||(21209946-21210038)
chr5 (8-100)||(24269896-24269987)
chr5 (8-100)||(25258326-25258418)
chr5 (8-100)||(25322116-25322208)
chr5 (8-100)||(27133018-27133110)
chr5 (14-82)||(37656968-37657036)
chr5 (9-85)||(37782076-37782152)
chr5 (29-100)||(17150279-17150350)
chr5 (8-98)||(9368799-9368889)
chr5 (19-100)||(6637570-6637650)
chr5 (7-100)||(17017115-17017208)
chr5 (15-100)||(17352467-17352551)
chr5 (8-73)||(24528534-24528599)
chr5 (16-89)||(30758332-30758405)
chr5 (8-96)||(1564592-1564680)
chr5 (8-100)||(24346762-24346854)
chr5 (14-85)||(37781709-37781778)
chr5 (8-100)||(42295546-42295638)
chr5 (8-100)||(15480524-15480618)
chr5 (27-98)||(31181055-31181126)
chr5 (26-100)||(4481606-4481680)
chr5 (26-96)||(15438848-15438918)
chr5 (14-100)||(29909518-29909604)
chr5 (27-100)||(6637804-6637877)
chr5 (8-69)||(24531597-24531658)
chr5 (8-88)||(6413451-6413531)
chr5 (8-100)||(8098518-8098610)
chr5 (16-100)||(30770082-30770166)
chr5 (15-94)||(2061970-2062049)
chr5 (16-103)||(30770298-30770385)
chr5 (14-100)||(37656582-37656666)
chr5 (14-100)||(13296859-13296945)
chr5 (8-97)||(18333724-18333814)
chr5 (8-73)||(24270130-24270195)
chr5 (15-100)||(24487677-24487762)
chr5 (14-62)||(60092-60140)
chr5 (16-100)||(6919227-6919311)
chr5 (8-96)||(7369695-7369783)
chr5 (8-100)||(7607561-7607653)
chr5 (16-100)||(12034657-12034741)
chr5 (14-98)||(13701099-13701183)
chr5 (8-72)||(19522082-19522146)
chr5 (8-87)||(20225021-20225100)
chr5 (14-89)||(21306865-21306940)
chr5 (14-89)||(21314703-21314778)
chr5 (8-101)||(33337480-33337569)
chr5 (8-62)||(17584178-17584232)
chr5 (8-100)||(6413682-6413773)
chr5 (8-68)||(15438986-15439046)
chr5 (8-96)||(28510062-28510150)
chr5 (15-62)||(170583-170630)
chr5 (25-100)||(3859350-3859425)
chr5 (18-73)||(43117876-43117931)
chr5 (8-98)||(8287771-8287860)
chr5 (14-100)||(13296640-13296726)
chr5 (15-100)||(13700621-13700707)
chr5 (26-100)||(17352711-17352785)
chr5 (8-50)||(25258119-25258161)
chr5 (8-50)||(25321909-25321951)
chr5 (26-100)||(38731646-38731720)
chr5 (14-68)||(38976932-38976986)
chr5 (15-100)||(11895948-11896032)
chr5 (8-57)||(29909746-29909795)
chr5 (15-68)||(38731870-38731923)
chr5 (8-96)||(7092121-7092208)
chr5 (8-100)||(19522288-19522379)
chr5 (8-100)||(37405056-37405148)
chr5 (27-98)||(11896729-11896800)
chr5 (37-100)||(13358368-13358431)
chr5 (30-73)||(17899507-17899550)
chr5 (18-65)||(20510910-20510957)
chr5 (17-68)||(32908752-32908803)
chr5 (14-68)||(16571491-16571545)
chr5 (26-100)||(24528742-24528815)
chr5 (14-100)||(29239881-29239964)
chr5 (27-68)||(2985272-2985313)
chr5 (26-67)||(6919471-6919512)
chr5 (28-100)||(15590140-15590213)
chr5 (17-62)||(16707059-16707104)
chr5 (8-65)||(17015904-17015961)
chr5 (9-62)||(25436206-25436259)
chr5 (25-98)||(36040518-36040591)
chr5 (28-100)||(18885429-18885500)
chr5 (14-98)||(26137140-26137224)
[»] scaffold0519 (2 HSPs)
scaffold0519 (8-100)||(2118-2210)
scaffold0519 (8-101)||(1882-1975)
[»] scaffold0129 (2 HSPs)
scaffold0129 (8-89)||(14281-14362)
scaffold0129 (45-99)||(14506-14560)
[»] scaffold0334 (1 HSPs)
scaffold0334 (8-100)||(4454-4546)
[»] scaffold0047 (2 HSPs)
scaffold0047 (15-99)||(12615-12699)
scaffold0047 (18-100)||(12848-12930)
[»] scaffold0400 (1 HSPs)
scaffold0400 (8-98)||(3813-3904)
[»] scaffold0365 (1 HSPs)
scaffold0365 (8-98)||(4457-4548)
[»] scaffold0766 (1 HSPs)
scaffold0766 (8-100)||(6241-6333)
[»] scaffold0005 (2 HSPs)
scaffold0005 (8-96)||(288682-288770)
scaffold0005 (8-103)||(56423-56518)
[»] scaffold0001 (1 HSPs)
scaffold0001 (42-99)||(429841-429898)
[»] scaffold0092 (2 HSPs)
scaffold0092 (8-100)||(5622-5714)
scaffold0092 (32-100)||(5857-5925)
[»] scaffold0060 (1 HSPs)
scaffold0060 (16-100)||(20542-20626)
[»] scaffold0692 (2 HSPs)
scaffold0692 (8-99)||(5779-5870)
scaffold0692 (8-67)||(5569-5628)
[»] scaffold0083 (1 HSPs)
scaffold0083 (8-67)||(51236-51295)
[»] scaffold0050 (1 HSPs)
scaffold0050 (8-99)||(69558-69649)
[»] scaffold0027 (1 HSPs)
scaffold0027 (14-100)||(121520-121606)
[»] scaffold0481 (1 HSPs)
scaffold0481 (8-100)||(3496-3588)
[»] scaffold0048 (2 HSPs)
scaffold0048 (8-100)||(81809-81901)
scaffold0048 (8-100)||(82043-82135)
[»] scaffold0459 (2 HSPs)
scaffold0459 (21-87)||(13081-13147)
scaffold0459 (27-100)||(13300-13373)
[»] scaffold0366 (4 HSPs)
scaffold0366 (21-87)||(10722-10788)
scaffold0366 (21-87)||(14388-14454)
scaffold0366 (27-100)||(10941-11014)
scaffold0366 (27-100)||(14607-14680)
[»] scaffold0181 (1 HSPs)
scaffold0181 (8-74)||(20932-20998)
[»] scaffold0041 (2 HSPs)
scaffold0041 (8-62)||(67490-67544)
scaffold0041 (26-62)||(67283-67319)


Alignment Details
Target: chr8 (Bit Score: 131; Significance: 9e-68; HSPs: 100)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 131; E-Value: 9e-68
Query Start/End: Original strand, 338 - 480
Target Start/End: Original strand, 22510138 - 22510280
Alignment:
338 caaacaacaaatatatgcacttacgtgtgagtgcggaaaattgatttgcaataacttctggaggtgaagtatgagtaaaaggaaaggagaaaagaaacac 437  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||    
22510138 caaacaacaaatatatgcacttacgtgtgagtgcggaaaattgatttgcaagaaattctggaggtgaattatgagtaaaaggaaaggagaaaagaaacac 22510237  T
438 cgttggtgaccggttaacgatcgatcagcgtgtcaccggccaa 480  Q
    |||||||||||||||||||||||||||||||||||||||||||    
22510238 cgttggtgaccggttaacgatcgatcagcgtgtcaccggccaa 22510280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 101 - 228
Target Start/End: Original strand, 22510018 - 22510145
Alignment:
101 gaagggtctcactcttaataaacaagagttgttaacaaaattgtatatgccaaataaaaccatctttcactaatcatacactttcaatacatacagtata 200  Q
    |||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22510018 gaagggtctcactcttaataaacaacccttgttaacaaaattgtatatgccaaataaaaccatctttcactaatcatacactttcaatacatacagtata 22510117  T
201 agaagtttaccctaaaacatcaatcaac 228  Q
    ||||||||||||||||||||||| ||||    
22510118 agaagtttaccctaaaacatcaaacaac 22510145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 39052954 - 39053046
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||    
39052954 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca 39053046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 24532446 - 24532538
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||| |||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||    
24532446 acaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggccatctcctatccgatgtgggactcttaaca 24532538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 35682806 - 35682898
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||| |||||||||||||||||||| ||||||||||||||||||||||  ||| |||||||||||||||||||||    
35682806 acaaccccacaaaaccggcttgcgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtggaactcttaaca 35682898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 17469877 - 17469784
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||| |||||||||||    
17469877 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacag 17469784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 11232219 - 11232311
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||  ||| |||||||||| ||||||||||    
11232219 acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca 11232311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 17477124 - 17477032
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
17477124 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 17477032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 19256611 - 19256703
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
19256611 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 19256703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 5931980 - 5932066
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||   ||||| ||||||| ||||||||||    
5931980 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtactatctgatgtgggactcttaaca 5932066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 41790712 - 41790626
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||| |||||||||||||| |||||| |||||||||||||||||| |||||||||| |||||||||||| ||||||    
41790712 ccacaaaaccggcttatgaggtgaggattgtccccacttataaacacattgtcaggtcatcacctattcgatgtggaacttttaaca 41790626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 3157584 - 3157677
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccccc-acatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| | ||||||||||||||||||||||| || |||||| |||||| |||||||||||||||||||||||| ||||||||||    
3157584 acaaccccacaaaactggcttgtgaggtgaggattgccccccacttataaatacattgccaggccatcacctatccgatgtgggactcttaaca 3157677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 11232454 - 11232547
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||| ||||  ||| |||||||||| |||||||||||    
11232454 acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtccgatgtgggactcttaacag 11232547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 19256845 - 19256938
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||  ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||| |||||||||||    
19256845 acaaccccacaaaacctgcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacag 19256938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 38447452 - 38447533
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| | |||||| |||||    
38447452 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatctcttatccgttgtgg 38447533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 27 - 100
Target Start/End: Original strand, 39052581 - 39052654
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||    
39052581 ttgttaggtgaggattgcccccacttataaacacattgtcaggccatcacctatctgatgtgggactcttaaca 39052654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 39960251 - 39960158
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccccc-acatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||| || |||||||| ||| |||||||||| |||||||||||||| ||||||||||    
39960251 acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaattttcaggccatctcctatccgatgtgggactcttaaca 39960158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 24075331 - 24075423
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| | |||||||||| | |||| ||||||||| ||||||||||    
24075331 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaagtgtcaggccaactcctaaccgatgtgggactcttaaca 24075423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 7 - 101
Target Start/End: Complemental strand, 25325706 - 25325612
Alignment:
7 aacaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    |||||| ||||||||| | ||||||||| ||||||||| ||||| |||||||||||||| |||||||  |||||||||||||| |||||||||||    
25325706 aacaactccacaaaactggcttgtgaggagaggattgcacccacttataaacacattgttaggccatgtcctatccgatgtgggactcttaacag 25325612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 31197900 - 31197814
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||| |||| |||||||||||||||||||| | |||| || ||||||||||||||||||||||||||| ||||||| ||||||||||    
31197900 ccaccaaactgacttgtgaggtgaggattgtctccacttacaaacacattgtcaggccatcacctatctgatgtgggactcttaaca 31197814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 5590400 - 5590485
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||| ||||||||||||||||| | ||||||||||||||| ||||| |||||||||||||| ||||| ||||    
5590400 cacaaaaccggcttgtgaagtgaggattgcccccacttgtaaacacattgtcagaccatctcctatccgatgtgggactctgaaca 5590485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 36917464 - 36917557
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||| ||||||||| ||||||||| ||||||| |||||| ||||||||||||||| ||||||| ||||||  |||||||||||    
36917464 acaaccccacaaaactgacttgtgatgtgaggattacccccacttataaatacattgtcaggccattacctatctgatgtgagactcttaacag 36917557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 4828352 - 4828264
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| ||||||| |||| | |||| ||||||||| ||||||    
4828352 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcatgccaactcctaaccgatgtgggactctt 4828264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 16 - 96
Target Start/End: Complemental strand, 7729992 - 7729912
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||||| ||||||||||| | |||| ||||||| ||||||    
7729992 acaaaaccggcttgtgaggtgaggattgcccccacttataaacacatggtcaggccatctcatatctgatgtgggactctt 7729912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 10450051 - 10449967
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| ||| ||||||||||||||||| ||| ||||||||||||||||||||||  |||||||||||||  ||||||||||    
10450051 acaaaaccggcttctgaggtgaggattgcccacacttataaacacattgtcaggccatgtcctatccgatgtgagactcttaaca 10449967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 34842737 - 34842645
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||||| | ||||||||||||||||||||| |||||||| |||||||||||| | |||| | ||||||| ||||||||||    
34842737 acaaccccacaaaaccgacctatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaactgatgtgggactcttaaca 34842645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 39743588 - 39743496
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| || |||||||||||||||||||||| || |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
39743588 acaaccccacaaaatcggcttgtgaggtgaggattgccccaacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 39743496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 8929076 - 8928997
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgt 87  Q
    ||||| ||||||||||| ||||||||||| ||||||||||||  ||||||||||||||||||||||| | ||||||||||    
8929076 acaaccccacaaaaccggcttgtgaggtgcggattgcccccagttataaacacattgtcaggccatctcatatccgatgt 8928997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 8 - 102
Target Start/End: Original strand, 42846630 - 42846725
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccc-ccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacaga 102  Q
    ||||| ||||||||||| ||||||||||||||||||||| |||| |||||||| |||||||||||| | |||| ||||||||  ||||||||||||    
42846630 acaaccccacaaaaccggcttgtgaggtgaggattgccctccacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaacaga 42846725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 422248 - 422334
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| | |||||||||||||||||||| |||| | ||||||||||||||| ||||| |||||||||||||| ||| ||||||    
422248 ccacaaaactggcttgtgaggtgaggattgcctccacttttaaacacattgtcagaccatctcctatccgatgtgggacttttaaca 422334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 18 - 96
Target Start/End: Original strand, 29907761 - 29907839
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    |||||||||||||||||||||||||| |||||| ||||||||||||||||| | ||| | |||||||||||| ||||||    
29907761 aaaaccgacttgtgaggtgaggattgaccccacttataaacacattgtcagactatctcttatccgatgtgggactctt 29907839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 8 - 97
Target Start/End: Complemental strand, 12688366 - 12688277
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctta 97  Q
    ||||| ||||||||| | |||||||||| |||||||||||||| |||||||||||||||||| ||||  |||||| |||||| |||||||    
12688366 acaaccccacaaaactggcttgtgaggtaaggattgcccccacttataaacacattgtcaggtcatcttctatccaatgtgggactctta 12688277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 18004128 - 18004213
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||| || |||||||||||||||||| |||||||| |||||||||||||  ||| || ||||||| ||||||||||    
18004128 cacaaaaccgacttatggggtgaggattgcccccacttataaacatattgtcaggccatgtcctgtctgatgtgggactcttaaca 18004213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 20301313 - 20301228
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| | |||||||||| |||||||||||||| |||||||||||||||| |||||| | ||||| |||||| ||||||||||    
20301313 cacaaaacgggcttgtgaggttaggattgcccccacttataaacacattgtcaagccatctcatatccaatgtggtactcttaaca 20301228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 21087945 - 21087860
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| | |||||||||| |||||||||||||| |||||||||||||||| |||||| | ||||| |||||| ||||||||||    
21087945 cacaaaacgggcttgtgaggttaggattgcccccacttataaacacattgtcaagccatctcatatccaatgtggtactcttaaca 21087860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 27 - 100
Target Start/End: Original strand, 28069401 - 28069474
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||||||||| |||||| |||||||||||||||  | |||||||||||| ||||||||||    
28069401 ttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcatatccgatgtgggactcttaaca 28069474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 15042695 - 15042787
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| ||  ||| ||||||| |||||||||||| ||||||||||||||||||||||  | |||||||||||| ||||||||||    
15042695 acaaccccacaaaatcggtttgcgaggtgatgattgcccccacttataaacacattgtcaggccatgtcgtatccgatgtgggactcttaaca 15042787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 34843176 - 34843084
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||| ||||| |||||||| ||||| || ||| | |||| ||||||||| ||||||||||    
34843176 acaaccccacaaaaccggcttgtgaggtgaggattgctcccacttataaacaaattgttagaccaactcctaaccgatgtgggactcttaaca 34843084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 73
Target Start/End: Complemental strand, 7669694 - 7669635
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    |||||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||    
7669694 ccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacattgtcagaccat 7669635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 30 - 100
Target Start/End: Complemental strand, 12317083 - 12317013
Alignment:
30 tgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||| ||||||||||||||||| ||||  ||| |||||||||| ||||||||||    
12317083 tgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtccgatgtgggactcttaaca 12317013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 37001285 - 37001219
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||| |||| ||||||||    
37001285 acaactccacaaaaccggcttgtgaggtgaggattgcccccacctataaacactttgtgaggccatc 37001219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 5932209 - 5932290
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    ||||| ||||||||| | |||||||||||||| |||||||||| |||||||||||||| || ||||  ||||||||||||||    
5932209 acaaccccacaaaacaggcttgtgaggtgaggcttgcccccacttataaacacattgttagaccatgtcctatccgatgtgg 5932290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 16 - 101
Target Start/End: Original strand, 7267498 - 7267583
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||||||| |||||||||||| |||||||||||| |||||||| ||||||| |||| | |||| ||||||||  |||||||||||    
7267498 acaaaaccggcttgtgaggtgatgattgcccccacttataaacaaattgtcaagccaactcctaaccgatgtgtgactcttaacag 7267583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 27 - 100
Target Start/End: Original strand, 20094604 - 20094677
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||| |||| ||||||| ||||||||||||||||||||||||||||||  |||| |||||||| ||||||||||    
20094604 ttgtaaggtaaggattgtccccacatataaacacattgtcaggccatcttctattcgatgtgggactcttaaca 20094677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 27 - 96
Target Start/End: Original strand, 34236692 - 34236761
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    |||||||||||||||||| ||||| ||||||||||||||||| ||||| | |||||||||||| ||||||    
34236692 ttgtgaggtgaggattgctcccacttataaacacattgtcagaccatctcttatccgatgtggcactctt 34236761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 35385836 - 35385929
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattg-cccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||| |||||||||||||| ||||||| |||||||| ||| |||||| |||  ||||||||||||| ||||||||||    
35385836 acaaccccacaaaaccggcttatgaggtgaggattgccccccacttataaacatattatcaggctatcttctatccgatgtgggactcttaaca 35385929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 4828127 - 4828039
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||||||||| |||||||||||||||||| |||||| |||||||| ||||||| | || | |||| ||||||||| ||||||    
4828127 acaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacaaattgtcatgtcaactcctaaccgatgtgggactctt 4828039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 14 - 74
Target Start/End: Complemental strand, 20515197 - 20515137
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    ||||||||||| ||||||| |||||||||||||| || |||||||||||||||||||||||    
20515197 ccacaaaaccggcttgtgatgtgaggattgccccgacttataaacacattgtcaggccatc 20515137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 22638204 - 22638284
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||| ||||||||||| |||||| ||||||||||||||| || ||||||||| ||| ||||||||| | |||||||||||    
22638204 acaaccccacaaaaccggcttgtgtggtgaggattgcccctacttataaacactttgacaggccatctcttatccgatgtg 22638284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 31197666 - 31197582
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||| ||||||||| ||| |||  || ||||||||||||||||| |||||||||||| ||||| | ||||||||||    
31197666 acaaaaccgacttttgaggtgagaattacccttacttataaacacattgtcagaccatcacctatctgatgtaggactcttaaca 31197582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 37001523 - 37001443
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||| ||||||||||| ||||||| |||||||||| |||||| ||||||||| ||||||||||||  ||| |||||||||    
37001523 acaaccccacaaaaccggcttgtgatgtgaggattgtccccacttataaacactttgtcaggccatttcctgtccgatgtg 37001443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 3157051 - 3157126
Alignment:
26 cttgtgaggtgaggattgccccc-acatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||||| || ||||||||||||||  |||||||| ||||||||||||  ||||||||||    
3157051 cttgtgaggtgaggattgccccccacttataaacacattgttgggccatcatctatccgatgtgagactcttaaca 3157126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 14 - 72
Target Start/End: Complemental strand, 10884118 - 10884059
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgc-ccccacatataaacacattgtcaggcca 72  Q
    ||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||    
10884118 ccacaaaaccggcttgtgaggtgaggattgccccccacttataaacacattgtcaggcca 10884059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 7 - 74
Target Start/End: Original strand, 20094818 - 20094885
Alignment:
7 aacaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    |||||| ||||||||||| ||||| |||||||||||||||||||||||||||| ||||| || |||||    
20094818 aacaaccccacaaaaccggcttgtaaggtgaggattgcccccacatataaacatattgtaagaccatc 20094885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 8 - 99
Target Start/End: Complemental strand, 39984873 - 39984782
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    ||||| ||||||||| | ||||||||||||||||||||||||| |||||||| |||||||| ||| | ||||  |||||||  |||||||||    
39984873 acaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaatcgatgtgagactcttaac 39984782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 13 - 74
Target Start/End: Complemental strand, 20301555 - 20301494
Alignment:
13 accacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    |||||| ||||| |||||| |||||||||||||||||| |||||||||||||||| ||||||    
20301555 accacacaaccggcttgtggggtgaggattgcccccacttataaacacattgtcatgccatc 20301494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 13 - 74
Target Start/End: Complemental strand, 21088187 - 21088126
Alignment:
13 accacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    |||||| ||||| |||||| |||||||||||||||||| |||||||||||||||| ||||||    
21088187 accacacaaccggcttgtggggtgaggattgcccccacttataaacacattgtcatgccatc 21088126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 14 - 87
Target Start/End: Original strand, 37868379 - 37868452
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgt 87  Q
    ||||||||||| |||||||||||||||||||||||||  |||||||| |  |||||||||||  ||||||||||    
37868379 ccacaaaaccggcttgtgaggtgaggattgcccccactaataaacacgtgttcaggccatcatttatccgatgt 37868452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 12547157 - 12547066
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||| ||||| |||||| |||||| | |||||||| ||| | |||| ||||||||| ||||||||||    
12547157 acaaccccacaaaaccggcttgtgaggtgaagattg-ccccacttataaataaattgtcagaccaactcctaaccgatgtgggactcttaaca 12547066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 16050088 - 16050008
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||| ||||||||| ||||||||||||||||||||||  ||| |||||||| ||| |||||||| | |||| ||||||||    
16050088 acaaccccacaaaactgacttgtgaggtgaggattgccttcacttataaacaaattatcaggccaactcctaaccgatgtg 16050008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 3157352 - 3157441
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccccc-acatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| | ||||||||||||||||||||||| || |||||||||||||||||||   ||||||||| |||||  ||||||||||    
3157352 acaaccccacaaaacag-cttgtgaggtgaggattgccccccacttataaacacattgtcaggc---cacctatcccatgtgagactcttaaca 3157441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 95
Target Start/End: Original strand, 26800537 - 26800624
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactct 95  Q
    ||||| ||||||||||| |||||| |||||||||||||||||| |||| ||| ||| |||||||| |  ||| ||||||||| |||||    
26800537 acaaccccacaaaaccggcttgtgtggtgaggattgcccccacttatagacaaattatcaggccaacttctaaccgatgtgggactct 26800624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 20702849 - 20702763
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgc-ccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||| |||| |||||||||| |||||| |||||||| | |||||||||| | |||| ||||||||| ||||||||||    
20702849 cacaaaaccggcttatgagatgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcttaaca 20702763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 8 - 74
Target Start/End: Original strand, 27439572 - 27439638
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    ||||| ||||||||||  ||||||||| |||||||| ||| || |||||||||||||||||||||||    
27439572 acaacgccacaaaaccagcttgtgaggcgaggattgaccctacttataaacacattgtcaggccatc 27439638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 14 - 96
Target Start/End: Original strand, 30201555 - 30201637
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||||||||| |||||||||||| ||||| |||||| |||||||  |||| || |||||| | |||||||||||| ||||||    
30201555 ccacaaaaccggcttgtgaggtgaagattgaccccacttataaacttattgccatgccatctcttatccgatgtgggactctt 30201637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 14 - 96
Target Start/End: Original strand, 37868614 - 37868696
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||||||||  ||||||||||||||||||||||||   ||||||||||  |||||||||||  | |||||||||| ||||||    
37868614 ccacaaaaccagcttgtgaggtgaggattgcccccattaataaacacatgttcaggccatcatttgtccgatgtgggactctt 37868696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 15 - 88
Target Start/End: Original strand, 4873723 - 4873795
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    |||||||||| ||||||||||||| |||||| | || |||||||||||||||||| |||| | |||||||||||    
4873723 cacaaaaccggcttgtgaggtgagaattgccac-acttataaacacattgtcaggtcatctcttatccgatgtg 4873795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 8084186 - 8084105
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    ||||| || |||||||  ||||||||||||||||||||||||| |||||| |||||||||| | ||  ||| ||||||||||    
8084186 acaactccgcaaaaccagcttgtgaggtgaggattgcccccacttataaatacattgtcagactatgtcctgtccgatgtgg 8084105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 14 - 87
Target Start/End: Original strand, 28213352 - 28213425
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgt 87  Q
    ||||||||||||||||||||||||| | || |||||| |||||| |||||||||| | ||| | ||||||||||    
28213352 ccacaaaaccgacttgtgaggtgagaaatgtccccacttataaatacattgtcagactatctcttatccgatgt 28213425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 59 - 100
Target Start/End: Original strand, 39052770 - 39052811
Alignment:
59 acattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
39052770 acattgtcaggccatcacctatccgatgtgggactcttaaca 39052811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 4873490 - 4873574
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||| ||||||||||||||| ||| |||||||  ||||   ||||||||| ||||| | |||||||||||| ||||||||||    
4873490 acaaaactgacttgtgaggtgagtattacccccactgataactgcattgtcagaccatctcttatccgatgtgggactcttaaca 4873574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 5675759 - 5675847
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| |||||||| |  ||||||||||||| |||| | | || ||||||||||||||||| |||||| ||||||||||| | ||||||    
5675759 acaactccacaaaatcagcttgtgaggtgagaattgtctctacttataaacacattgtcagaccatcatctatccgatgtaggactctt 5675847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 16050319 - 16050228
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||| |||||||||||||| || ||| |||||| | |||||||||||| | |||| ||||||||  ||||||||||    
16050319 acaaccccacaaaaccggctt-tgaggtgaggattgtcctcacttataaataaattgtcaggccaactcctaaccgatgtgagactcttaaca 16050228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 16 - 60
Target Start/End: Complemental strand, 38475798 - 38475754
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||    
38475798 acaaaaccggcttgtgaggtgaggattgcccccacttataaacac 38475754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 40014711 - 40014663
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||||||||||||||||| |||| |||||||||||| |||||||||||    
40014711 ccacaaaaccgacttgtgaagtgaagattgcccccacttataaacacat 40014663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 16 - 96
Target Start/End: Original strand, 44931215 - 44931295
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||||||| ||||||||| ||||||||||||||| ||||||||| |  |||||||||| |  | ||||||||| ||||||    
44931215 acaaaaccggcttgtgaggcgaggattgcccccacttataaacacttattcaggccatctctcaaccgatgtgggactctt 44931295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 15 - 62
Target Start/End: Original strand, 42049719 - 42049766
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||||||||| |||||| |||||||||||||||||| |||||||||||    
42049719 cacaaaaccggcttgtggggtgaggattgcccccacttataaacacat 42049766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 26 - 96
Target Start/End: Complemental strand, 5940099 - 5940029
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    |||||||||||||||||| |||||  ||||||||||||||||  ||||| |  ||||||||||| ||||||    
5940099 cttgtgaggtgaggattgtccccatttataaacacattgtcaaaccatctctcatccgatgtgggactctt 5940029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 68
Target Start/End: Complemental strand, 12688125 - 12688071
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    ||||||||||| ||||||||||| ||||||||| ||| |||||||||||| ||||    
12688125 ccacaaaaccggcttgtgaggtggggattgccctcacttataaacacattatcag 12688071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 38476336 - 38476270
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    ||||| |||||||| || ||||||||||||||||| ||||||| ||||||||| |  ||||||||||    
38476336 acaaccccacaaaatcggcttgtgaggtgaggatttcccccacttataaacacttattcaggccatc 38476270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 14 - 75
Target Start/End: Original strand, 37868103 - 37868164
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatca 75  Q
    ||||||||||| |||||| ||||||||||||||||||  |||||||| |  |||||||||||    
37868103 ccacaaaaccggcttgtgtggtgaggattgcccccactaataaacacgtgttcaggccatca 37868164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 6559481 - 6559525
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaaca 59  Q
    |||||||||| ||||| ||||||||||||||||||| ||||||||    
6559481 cacaaaaccggcttgtaaggtgaggattgcccccacttataaaca 6559525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 27205023 - 27204975
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataa 56  Q
    ||||| ||||||||||| ||| ||||||||||||||||||||| |||||    
27205023 acaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27204975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 27205121 - 27205073
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataa 56  Q
    ||||| ||||||||||| ||| ||||||||||||||||||||| |||||    
27205121 acaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27205073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 27205219 - 27205171
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataa 56  Q
    ||||| ||||||||||| ||| ||||||||||||||||||||| |||||    
27205219 acaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27205171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 27 - 99
Target Start/End: Original strand, 29099784 - 29099856
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    ||||||||||| ||||||| |||| ||||||||||||||||| |||||  |||| |||| ||  |||||||||    
29099784 ttgtgaggtgaagattgcctccacttataaacacattgtcagaccatcttctattcgatatgagactcttaac 29099856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 64
Target Start/End: Original strand, 30966100 - 30966148
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattg 64  Q
    ||||||||| ||||| ||||||||| ||||||||| |||||||||||||    
30966100 acaaaaccggcttgtaaggtgaggactgcccccacttataaacacattg 30966148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 52 - 100
Target Start/End: Complemental strand, 44354070 - 44354023
Alignment:
52 tataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||| |||||||||||||||||||||||| |||| |||||    
44354070 tataaacacattg-caggccatcacctatccgatgtgggactcctaaca 44354023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 14 - 69
Target Start/End: Complemental strand, 42584727 - 42584672
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcagg 69  Q
    |||||||| || || || ||||||| ||||||||||| ||||||||||||||||||    
42584727 ccacaaaatcggctggtaaggtgagtattgcccccacttataaacacattgtcagg 42584672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 27 - 89
Target Start/End: Original strand, 8466532 - 8466594
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    |||||||||||||||| ||||||| ||||||||| |  |||| ||||| | ||||||||||||    
8466532 ttgtgaggtgaggatttcccccacttataaacacttgttcagaccatctcttatccgatgtgg 8466594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 66
Target Start/End: Original strand, 15042911 - 15042969
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtc 66  Q
    ||||| |||||||||||  ||  ||||| |||||||||||||| |||||||||||||||    
15042911 acaaccccacaaaaccggtttacgaggtaaggattgcccccacttataaacacattgtc 15042969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 28213147 - 28213220
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||||| | || ||||||||||||||||| ||||| | ||||  ||| || ||||||||||    
28213147 cttgtgaggtgaggattgccgc-acttataaacacattgtcagaccatctcatatcttatgcgggactcttaaca 28213220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 14 - 60
Target Start/End: Original strand, 37867863 - 37867909
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    ||||||||||| ||||||||||||| |||||||||||  ||||||||    
37867863 ccacaaaaccggcttgtgaggtgagaattgcccccactaataaacac 37867909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 8084402 - 8084329
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||| || ||||||| |||||| ||||||| |||||||  | | | |||||||| ||||||||||    
8084402 ttgtgaggtgaggtttacccccacttataaatacattgttaggccatgtcttgttcgatgtgggactcttaaca 8084329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 8716173 - 8716096
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgat 85  Q
    ||||| |||||||| || ||| ||||||||||||||||  ||| | |||||||||||| || ||||| | ||||||||    
8716173 acaaccccacaaaatcggcttatgaggtgaggattgccttcacttttaaacacattgtgagaccatctcttatccgat 8716096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 18939340 - 18939373
Alignment:
26 cttgtgaggtgaggattgcccccacatataaaca 59  Q
    ||||||||||||||||||||||||| ||||||||    
18939340 cttgtgaggtgaggattgcccccacttataaaca 18939373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 8466749 - 8466801
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    ||||| ||| ||||||  |||||||||||||||||| |||||| |||||||||    
8466749 acaaccccataaaaccagcttgtgaggtgaggattgtccccacttataaacac 8466801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 10615683 - 10615635
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||||||||||||||| ||| ||||||| ||| ||| |||||||||||    
10615683 ccacaaaaccgacttgtaaggagaggattaccctcacttataaacacat 10615635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 31079605 - 31079641
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||||||||||||||||||| |||| |||||||||||    
31079605 cttgtgaggtgaggattgcctccacttataaacacat 31079641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 52 - 100
Target Start/End: Original strand, 44356523 - 44356570
Alignment:
52 tataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||| ||||| ||||||||||||||||| |||| |||||    
44356523 tataaacacattgt-aggccctcacctatccgatgtgggactcctaaca 44356570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 76; Significance: 6e-35; HSPs: 81)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 8 - 103
Target Start/End: Original strand, 40379469 - 40379564
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacagaa 103  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||    
40379469 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaacagaa 40379564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 94052 - 94137
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| ||||||||||    
94052 cacaaaaccgacttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaaca 94137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 17719451 - 17719367
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||    
17719451 acaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca 17719367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 40379234 - 40379326
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| ||||||||||    
40379234 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaaca 40379326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 16419561 - 16419469
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||  |||||||||||||| ||||||||||    
16419561 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatccgatgtgggactcttaaca 16419469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 7 - 100
Target Start/End: Complemental strand, 2029829 - 2029736
Alignment:
7 aacaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| ||||||||||| |||||||||||||||||||| |||| |||||||||||||||||| |||  |||||||||||||| ||||||||||    
2029829 aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca 2029736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 16533599 - 16533514
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| ||| | ||||||||||    
16533599 cacaaaaccggcttgtgaagtgaggattgcccccacttataaacacattgtcaggccatcacctatccggtgtaggactcttaaca 16533514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 5711464 - 5711556
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||  ||| |||||||||| ||||||||||    
5711464 acaaccccacaaaaccggcttgttaggtgaggattgcccccacttataaacacattgtcaggccatttcctttccgatgtgggactcttaaca 5711556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 32884166 - 32884074
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
32884166 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 32884074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 37812301 - 37812385
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| ||||||||||||||||||||| |||||| ||||||||||||||||||||||  |||||||||||||| ||||||||||    
37812301 acaaaatcgacttgtgaggtgaggattgtccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca 37812385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 33606085 - 33606171
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||  ||||||||||||||||||||| || |||||||||||| |||||||||| |||||||||||||| ||||||||||    
33606085 ccacaaaaccggtttgtgaggtgaggattgcccctacttataaacacattttcaggccatctcctatccgatgtgggactcttaaca 33606171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 14466435 - 14466528
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||||| ||||||||||||| ||||| ||||||||||||||||||||||  ||| |||||||||| |||||||||||    
14466435 acaaccccacaaaaccggcttgtaaggtgaggattgctcccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacag 14466528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 93156 - 93239
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| ||||| ||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||    
93156 acaaaaccggcttgtaaggtgaggagtgcccccacttataaacacattgtcagg-catcacctatccgatgtgggactcttaaca 93239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 2324299 - 2324207
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||| ||| | |||| ||||||||| ||||||||||    
2324299 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca 2324207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 2324533 - 2324441
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| |  ||| ||||||||| ||||||||||    
2324533 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaacttctaaccgatgtgggactcttaaca 2324441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 37812531 - 37812615
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| |||||||||||||||||||||||||||| |||||||||||||||||| |||  | |||||||||||| ||||||||||    
37812531 acaaaatcgacttgtgaggtgaggattgcccccacttataaacacattgtcaggtcatgtcttatccgatgtgggactcttaaca 37812615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 37840396 - 37840304
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||| ||||||| |||| |||||||||||||||||| |||| ||||||| |||||| ||||||||||    
37840396 acaaccccacaaaaccggcttgtgaggtgatgattgcctccacttataaacacattgtcaggtcatctcctatccaatgtgggactcttaaca 37840304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 17525369 - 17525455
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||  | | |||||||||| ||||||||||    
17525369 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcatgtccgatgtgggactcttaaca 17525455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 7 - 100
Target Start/End: Complemental strand, 2030064 - 2029971
Alignment:
7 aacaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| ||||||||||| |||||||||||||||||||| |||| |||||||||||||||||| |||  | | |||||||||| ||||||||||    
2030064 aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggtcatgtcatgtccgatgtgggactcttaaca 2029971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 28407818 - 28407911
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| ||||| ||||||   |||| ||||||||| |||||||||||    
28407818 acaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgttaggccaattcctaaccgatgtgggactcttaacag 28407911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 5711700 - 5711792
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||| | |||||| |||||||||||| ||||||||||||||||||||||  ||| |||||||||| ||||||||||    
5711700 acaaccccacaaaaccggcttttaaggtgatgattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca 5711792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 12343775 - 12343867
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| ||||| ||| ||||||||||||||||| ||||| ||||||||| | ||||| |||||||||||||| ||||||||||    
12343775 acaaccccacaaaactgacttatgatgtgaggattgcccccacttataagcacattgtctgaccatctcctatccgatgtgggactcttaaca 12343867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 15518811 - 15518727
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| ||||||||||| |||||||||| ||| |||||||||||||||||||  |||||||||| |||||| ||||||||||    
15518811 acaaaaccaacttgtgaggttaggattgccctcacttataaacacattgtcaggctgtcacctatccaatgtgggactcttaaca 15518727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 27897631 - 27897722
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||||||||||||||||| |||| |||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
27897631 acaaccccacaaaaccgacttgtgaggtgagaattg-ccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 27897722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 29718387 - 29718295
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||| ||| |||||||| ||||||| |||| | |||| ||||||||| ||||||||||    
29718387 acaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaagccaactcctaaccgatgtgggactcttaaca 29718295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 100
Target Start/End: Complemental strand, 4662281 - 4662198
Alignment:
17 caaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||| || ||||||||||||||||||||||| |||||||| ||||||||| |||  |||||||||||||| ||||||||||    
4662281 caaaaccaacctgtgaggtgaggattgcccccacttataaacatattgtcaggtcatgtcctatccgatgtgggactcttaaca 4662198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 31700776 - 31700865
Alignment:
14 ccacaaaaccgacttgtgaggtgagg---attgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||||||||||  |   ||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||    
31700776 ccacaaaaccggcttgtgaggtggtgggaattgccctcacttataaacacattgtcaggccatcacctatccgatgtgtaactcttaaca 31700865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 17854723 - 17854809
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||||| ||| |||||||||||| |||||||| |||||||||| | | |||| ||||||||| ||||||||||    
17854723 ccacaaaaccgacttgtgagatgatgattgcccccacttataaacagattgtcaggctaactcctaaccgatgtgggactcttaaca 17854809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 17854954 - 17855046
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||| ||| |||||||| ||||||||| || | |||| ||||||||  ||||||||||    
17854954 acaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaggtcaactcctaaccgatgtgagactcttaaca 17855046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 19191635 - 19191727
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||||||||| |||||| |||||||| | |||||||||| | |||| |||||| || ||||||||||    
19191635 acaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacaaactgtcaggccaactcctaaccgatgggggactcttaaca 19191727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 5509366 - 5509280
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||||| |||||||||||||||||| |||||||| |||||| ||||| | |||| | ||||||| ||||||||||    
5509366 ccacaaaaccggcttgtggggtgaggattgcccccacttataaacaaattgtcgggccaactcctaactgatgtgggactcttaaca 5509280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 24395922 - 24395837
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactc 94  Q
    ||||| |||||||| ||| ||||||||||||||||||||| ||  ||||||||||||| ||||||||||||||| ||||||| ||||    
24395922 acaaccccacaaaatcgatttgtgaggtgaggattgcccc-actcataaacacattgttaggccatcacctatctgatgtgggactc 24395837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 15 - 88
Target Start/End: Complemental strand, 14927154 - 14927081
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    |||||| | ||||| ||||||||||||||||||||| |||||||||||||||||| |||| | |||||||||||    
14927154 cacaaagctgacttatgaggtgaggattgcccccacttataaacacattgtcaggtcatctcttatccgatgtg 14927081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 37769968 - 37770061
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||| |||||||| |||||||||||| |||||||| |||||||  ||| | |||| ||||||||| |||||||||||    
37769968 acaaccccacaaaaccggcttatgaggtgaagattgcccccacttataaacaaattgtcaaaccaactcctaaccgatgtgggactcttaacag 37770061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 40149260 - 40149343
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||||||||| |||| |||||| |||||||||||||| ||| |||| | |||||||||||| ||||||||||    
40149260 cacaaaaccgacttgtgaggtgagaattg-ccccacttataaacacattgttaggtcatctcatatccgatgtgg-actcttaaca 40149343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 14 - 101
Target Start/End: Original strand, 5851713 - 5851803
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgt---caggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||||||||| |||||||||||||||||| |||||| |||||| |||||||   ||||||||  ||| |||||||||| |||||||||||    
5851713 ccacaaaaccggcttgtgaggtgaggattgtccccacttataaatacattgtcagcaggccatgtcctgtccgatgtgggactcttaacag 5851803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 15124573 - 15124665
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| || ||| ||||||| ||||||||||||| |||||||| |||||||| ||||   ||||||||||||| ||||||||||    
15124573 acaaccccacaaaatcggcttatgaggtggggattgcccccacttataaacatattgtcagaccatgttctatccgatgtgggactcttaaca 15124665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 16 - 88
Target Start/End: Original strand, 18607042 - 18607114
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||||||| ||| |||||||| ||||| ||||||  ||||||||||||||||||||||||||||| ||||||    
18607042 acaaaaccggcttttgaggtgatgattgtccccactaataaacacattgtcaggccatcacctatctgatgtg 18607114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 24396159 - 24396067
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||||||||||| |||||  ||| |||| || |||||||| ||||||||||||||   |||||||||||| ||||||||||    
24396159 acaaccccacaaaaccgacttgtggggtgataattacccctacttataaacatattgtcaggccatcttatatccgatgtgggactcttaaca 24396067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 40149028 - 40149120
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| || |||||||||||||||||| |||||| |||||||||| ||| ||| ||||  ||||||||||||  ||||||||||    
40149028 acaaccccacaaaatcggcttgtgaggtgaggattgtccccacttataaacacactgttaggtcatcttctatccgatgtgagactcttaaca 40149120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 5509138 - 5509048
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||| ||||||||||  ||||||||||||||||| ||||||| |||||||| |||||||| ||| | |||| ||||||||  ||||||||    
5509138 acaaccccacaaaaccagcttgtgaggtgaggattacccccacttataaacaaattgtcagaccaactcctaaccgatgtgtgactcttaa 5509048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 21 - 87
Target Start/End: Original strand, 44404196 - 44404262
Alignment:
21 accgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgt 87  Q
    |||| |||||||||||| |||||||||||| || ||||| |||||||| ||||||||||||||||||    
44404196 accggcttgtgaggtgatgattgcccccacttacaaacatattgtcagaccatcacctatccgatgt 44404262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 72
Target Start/End: Complemental strand, 14927352 - 14927288
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggcca 72  Q
    ||||| |||||||| || ||| ||||||||||||||||||||| |||||||| ||||||||||||    
14927352 acaactccacaaaatcggcttatgaggtgaggattgcccccacttataaacatattgtcaggcca 14927288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 15464828 - 15464736
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| |  |||||||||||||||||||||||| || | |||||||||||| ||||| | |||  |||||| |||||||||||    
15464828 acaaccccacaaaactggtttgtgaggtgaggattgcccccacttaaatacacattgtcagaccatctcatatttgatgtgaaactcttaaca 15464736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 25082562 - 25082654
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| | |||||||||||| ||||||||| || ||||||||||||||||| ||||| | |||| ||| ||  ||||||||||    
25082562 acaaccccacaaaactggcttgtgaggtgatgattgcccctacttataaacacattgtcagaccatctcttatctgatatgagactcttaaca 25082654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 32356444 - 32356353
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| | |||||| |||||||||||||||||| |||||||||||||||| | |||| | | |||||||||  ||||||||||    
32356444 acaactccacaaaactggcttgtg-ggtgaggattgcccccacttataaacacattgtcatgtcatctcatgtccgatgtgagactcttaaca 32356353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 9927952 - 9927893
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgat 85  Q
    ||||||||||||||||| ||||||| ||||||||||||||||| |||||  |||||||||    
9927952 cttgtgaggtgaggattacccccacttataaacacattgtcagaccatcttctatccgat 9927893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 9 - 100
Target Start/End: Original strand, 35418440 - 35418531
Alignment:
9 caacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||| ||| ||||||| ||||||||||||||||||||||||| |||||| | ||||| | | |||| ||||||||||||   ||||||||||    
35418440 caaccccataaaaccggcttgtgaggtgaggattgcccccacctataaatatattgttatgtcatctcctatccgatgtaagactcttaaca 35418531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 3738982 - 3738900
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||  |||||| ||||||||||||||||| |||||||||||| ||| | ||||  ||||||||||| | ||||||||||    
3738982 aaaaccggtttgtgatgtgaggattgcccccacttataaacacattatcatgtcatcttctatccgatgttggactcttaaca 3738900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 13486374 - 13486300
Alignment:
27 ttgtgaggtgaggattgccccc-acatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||||||| || |||||| | |||||||||||| | |||| ||||||||| ||||||||||    
13486374 ttgtgaggtgaggattgccccccacttataaataaattgtcaggccaactcctaaccgatgtgggactcttaaca 13486300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 38 - 100
Target Start/End: Original strand, 27036467 - 27036529
Alignment:
38 ggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
27036467 ggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 27036529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 36316082 - 36316168
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| | ||||| | ||||||||||||||||| |||||||| |||||||||||| |  ||| | ||||||| ||||||||||    
36316082 ccacaaaactggcttgtaatgtgaggattgcccccacttataaacaaattgtcaggccaacttctaactgatgtgggactcttaaca 36316168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 36351969 - 36352043
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||| |||| |||||| |||||||||||||||||| | || ||||||||||||   ||||||||||    
36351969 cttgtgaggtgagaattgtccccacttataaacacattgtcaggtcgtctcctatccgatgtaagactcttaaca 36352043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 43 - 100
Target Start/End: Original strand, 14466235 - 14466292
Alignment:
43 gcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| |||||||||||||| |||||||  ||| |||||||||||||||||||||    
14466235 gcccccacttataaacacattgttaggccatgtcctgtccgatgtggaactcttaaca 14466292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 21591841 - 21591748
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattg-cccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||| ||||||||||| |||||||| ||||| ||||||| |||||||| |||||||| ||| | ||||  |||||||| ||||||||||    
21591841 acaaccccataaaaccgacttatgaggtgaagattgccccccacttataaacaaattgtcagaccaactcctaatcgatgtgggactcttaaca 21591748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 36352184 - 36352241
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgt 65  Q
    ||||| ||||||||||| ||| |||||||| |||||||||||| ||||||||||||||    
36352184 acaaccccacaaaaccggcttttgaggtgatgattgcccccacttataaacacattgt 36352241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 27 - 100
Target Start/End: Original strand, 44403970 - 44404043
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||| | ||| || |||||||||||||||| ||||||||| ||||||   ||||||||||    
44403970 ttgtgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaaca 44404043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 11020599 - 11020547
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacct 78  Q
    |||||||||||||||||||| |||| |||||||||||| |||| |||||||||    
11020599 cttgtgaggtgaggattgcctccacttataaacacattttcagaccatcacct 11020547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 14 - 62
Target Start/End: Original strand, 19571005 - 19571053
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||||||| |||||| ||||||||||||||||||||| |||||||||||    
19571005 ccacaaaatcgacttatgaggtgaggattgcccccacttataaacacat 19571053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 40718232 - 40718324
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||||  ||||||||||| |||||||| ||| |||||||| ||||| ||| || | |||| ||||||||  ||||||||||    
40718232 acaactccacaaaaccggtttgtgaggtgatgattgccctcacttataaacaaattgttaggtcaactcctaaccgatgtgagactcttaaca 40718324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 42639639 - 42639731
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||  |||||||||||| ||||| |||||  ||||||||||||||||| ||||  | ||| | |||||| ||||||||||    
42639639 acaaccccacaaaaccagcttgtgaggtgacgattgtccccatttataaacacattgtcagaccatgtcatattcaatgtgggactcttaaca 42639731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 14 - 69
Target Start/End: Original strand, 19544402 - 19544456
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcagg 69  Q
    ||||||||||| ||||||||||||| ||||||||||| |||||||||||| |||||    
19544402 ccacaaaaccggcttgtgaggtgag-attgcccccacttataaacacattatcagg 19544456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 27 - 82
Target Start/End: Original strand, 24666276 - 24666331
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatcc 82  Q
    ||||||||||||||||||||| ||  ||||||||||| ||||| ||||||||||||    
24666276 ttgtgaggtgaggattgccccaactaataaacacattttcaggtcatcacctatcc 24666331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 88
Target Start/End: Complemental strand, 38629894 - 38629820
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    |||||||||||||||||||| ||||||||| ||| || |||||| ||||||||| | |||  | |||||||||||    
38629894 ccacaaaaccgacttgtgagatgaggattgtcccaacttataaatacattgtcatgtcatttcttatccgatgtg 38629820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 15 - 56
Target Start/End: Original strand, 93479 - 93520
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataa 56  Q
    |||||||||| ||||||||||||||||||||||||| |||||    
93479 cacaaaaccggcttgtgaggtgaggattgcccccacttataa 93520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 15 - 56
Target Start/End: Original strand, 93752 - 93793
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataa 56  Q
    |||||||||| ||||||||||||||||||||||||| |||||    
93752 cacaaaaccggcttgtgaggtgaggattgcccccacttataa 93793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 16 - 49
Target Start/End: Original strand, 10585001 - 10585034
Alignment:
16 acaaaaccgacttgtgaggtgaggattgccccca 49  Q
    ||||||||||||||||||||||||||||||||||    
10585001 acaaaaccgacttgtgaggtgaggattgccccca 10585034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 14 - 63
Target Start/End: Original strand, 33606320 - 33606369
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacatt 63  Q
    ||||||||| | ||||||||||||||||| ||||||| ||||||||||||    
33606320 ccacaaaactggcttgtgaggtgaggattacccccacttataaacacatt 33606369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 8424947 - 8424855
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| |  ||||||||||| |||||||||||| |||||| | |||||||| ||| | |||| | ||||||| ||| ||||||    
8424947 acaaccccacaaaactggtttgtgaggtgatgattgcccccacttataaataaattgtcagaccaactcctaactgatgtgggacttttaaca 8424855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 9 - 96
Target Start/End: Complemental strand, 10523311 - 10523224
Alignment:
9 caacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    |||| |||||||||   ||||||||||||||| ||  || || || |||||||||||||| ||||| | |||||||||||| ||||||    
10523311 caaccccacaaaactagcttgtgaggtgaggaatgttcctacttaaaaacacattgtcagaccatctcttatccgatgtgggactctt 10523224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 15124808 - 15124867
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtca 67  Q
    ||||| |||||||||||| |||||| |||| |||||||| ||| |||||||||| |||||    
15124808 acaaccccacaaaaccgaattgtgaagtgaagattgccctcacttataaacacactgtca 15124867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 62
Target Start/End: Complemental strand, 15988265 - 15988218
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||||||||| ||||||||||||||||| ||||||| |||||| ||||    
15988265 cacaaaaccggcttgtgaggtgaggatttcccccacttataaaaacat 15988218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 16 - 66
Target Start/End: Original strand, 1926474 - 1926524
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtc 66  Q
    |||||||||| |||||||||||||||| ||||||| |||||| | ||||||    
1926474 acaaaaccgatttgtgaggtgaggattacccccacttataaataaattgtc 1926524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 14 - 56
Target Start/End: Complemental strand, 15988465 - 15988423
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataa 56  Q
    ||||||||| | ||||||||||||||||||||||||| |||||    
15988465 ccacaaaactggcttgtgaggtgaggattgcccccacttataa 15988423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 14 - 88
Target Start/End: Original strand, 17525130 - 17525204
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||||||||| |||||| ||||||||||   ||||  |||||||||||||||||| |||  ||| |||||||||    
17525130 ccacaaaaccggcttgtgcggtgaggattcttcccatttataaacacattgtcaggtcatgtcctgtccgatgtg 17525204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 17719625 - 17719575
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaac 58  Q
    ||||| |||||||||||  ||||||||| |||||||||||||| |||||||    
17719625 acaaccccacaaaaccggtttgtgaggtcaggattgcccccacttataaac 17719575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 39 - 100
Target Start/End: Original strand, 25313569 - 25313631
Alignment:
39 gattgcccccacatataaa-cacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||| |||||| |||||||||||| ||||  |||||| |||||| ||||||||||    
25313569 gattgcccccacttataaaacacattgtcaggtcatctactatccaatgtgggactcttaaca 25313631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 14 - 59
Target Start/End: Complemental strand, 13210579 - 13210534
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaaca 59  Q
    ||||||||||||| ||||||||||||||||||| | | ||||||||    
13210579 ccacaaaaccgacctgtgaggtgaggattgccctctcttataaaca 13210534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 32 - 64
Target Start/End: Complemental strand, 4431689 - 4431657
Alignment:
32 aggtgaggattgcccccacatataaacacattg 64  Q
    ||||||||||||||||||| |||||||||||||    
4431689 aggtgaggattgcccccacttataaacacattg 4431657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 16 - 60
Target Start/End: Complemental strand, 8227400 - 8227356
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    ||||||||| || || ||||||||||||||||||| |||||||||    
8227400 acaaaaccgcctcgtaaggtgaggattgcccccacttataaacac 8227356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 27 - 71
Target Start/End: Original strand, 13296398 - 13296442
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggcc 71  Q
    |||||||||||||||| ||||||| |||||||| ||| |||||||    
13296398 ttgtgaggtgaggattacccccacttataaacatattatcaggcc 13296442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 74; Significance: 9e-34; HSPs: 97)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 50543592 - 50543685
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||||||||||    
50543592 acaactccacaaaaccggcttgtgaggtgaggattgcccccacttatacacacattgtcaggccatcacctatccgatgtgggactcttaacag 50543685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 28245551 - 28245643
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||  ||||||||||    
28245551 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgagactcttaaca 28245643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 8 - 104
Target Start/End: Complemental strand, 9279286 - 9279190
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacagaag 104  Q
    ||||| ||||||||||| || ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||  ||||||||||||||    
9279286 acaaccccacaaaaccggctagtgaggtgatgattgcccccacttataaacacattgtcaggccatcacctatccgatgtgcgactcttaacagaag 9279190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 53814954 - 53815046
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||||||||||||||    
53814954 acaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaaca 53815046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 31254439 - 31254524
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||  |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||    
31254439 cacaaaaccggtttgtaaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca 31254524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 11036771 - 11036863
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||| || || ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||    
11036771 acaaccccacacaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgttgtactcttaaca 11036863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 39902588 - 39902680
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||  ||||||||||||||||||||||||| ||||||||||||||||||||||  |||||||||||||| ||||||||||    
39902588 acaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca 39902680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 16 - 102
Target Start/End: Original strand, 27634549 - 27634635
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacaga 102  Q
    ||||||||| |||||||||||||||||||||||||  |||||||||||||||||||||  |||||||||||||| ||||||||||||    
27634549 acaaaaccggcttgtgaggtgaggattgcccccactcataaacacattgtcaggccatgtcctatccgatgtgggactcttaacaga 27634635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 35796774 - 35796859
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||  ||| |||||||||||||||||||||    
35796774 cacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcatgccatgtcctgtccgatgtggaactcttaaca 35796859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 21498854 - 21498762
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
21498854 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 21498762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 22231098 - 22231190
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||||||||| |||||| ||||||||||||||||||||||  |||||||||||| | ||||||||||    
22231098 acaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacacattgtcaggccatatcctatccgatgtaggactcttaaca 22231190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 16 - 96
Target Start/End: Complemental strand, 22827589 - 22827509
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||| ||||||    
22827589 acaaaaccggcttgtgaggtgaggattgcccccacttataaacacgttgtcaggccatctcctatccgatgtgggactctt 22827509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 35788718 - 35788626
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||  |||||| ||||||| ||||||||||    
35788718 acaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatctgatgtgggactcttaaca 35788626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 35788953 - 35788861
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||| |||||||||||||||| ||||||||||||||||||||||   ||||||||||||| ||||||||||    
35788953 acaaccccacaaaaccggcttgtgagatgaggattgcccccacttataaacacattgtcaggccatgttctatccgatgtgggactcttaaca 35788861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 50543355 - 50543447
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||| |||||||||||||||||| |||| |||||||||||| ||||||||||||||||||||  |||||||||    
50543355 acaaccccacaaaaccggcttgtggggtgaggattgcccccacttatacacacattgtcagaccatcacctatccgatgtggggctcttaaca 50543447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 21498407 - 21498321
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
21498407 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 21498321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 35645808 - 35645882
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||||||||    
35645808 cttgtgaggtgaggattgcccccacttataaacacattgtcagaccatcacctattcgatgtgggactcttaaca 35645882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 8 - 102
Target Start/End: Original strand, 53828548 - 53828642
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacaga 102  Q
    ||||| |||||||| || ||| ||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||||||||||||||||    
53828548 acaaccccacaaaatcggcttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaacaga 53828642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 22845472 - 22845565
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||  | |||| ||||||| |||||||||||    
22845472 acaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatgtcatatctgatgtgggactcttaacag 22845565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 22863533 - 22863440
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||  || |||||||||  |||||||||||    
22863533 acaaccccacaaaaccggcttgtggggtgaggattgcccccacttataaacacattgtcaggccatcttctgtccgatgtgagactcttaacag 22863440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 27 - 100
Target Start/End: Original strand, 27634125 - 27634198
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||  |||||||||||||| ||||||||||    
27634125 ttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca 27634198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 13555500 - 13555584
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| ||||||||||||||||| ||||||| ||||| ||||||||||  |||||||||||||||||||| ||||||||||    
13555500 acaaaaccggcttgtgaggtgaggatttcccccacttataagcacattgtcaaaccatcacctatccgatgtgggactcttaaca 13555584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 44118884 - 44118972
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||||||| | ||||||||||||||||| ||||||| ||||||||||||||||||||||| | |||||||||||| ||||||    
44118884 acaaccccacaaaacgggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatctcttatccgatgtgggactctt 44118972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 20822026 - 20821940
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||||||||||||| ||||||||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
20822026 ccacaaaaccggcttgtgaggtgagaattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 20821940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 35819160 - 35819245
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| | ||||||||| |||||||||||||||||||||||| |||||||||||| | |||| ||||||||| ||||||||||    
35819160 cacaaaactggcttgtgaggcgaggattgcccccacatataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 35819245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 5846430 - 5846346
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||||| |||| | |||| ||||||||| ||||||||||    
5846430 acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcatgccaactcctaaccgatgtgggactcttaaca 5846346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 35609515 - 35609607
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |  | |||||||| || |||| |||||| ||||||||||    
35609515 acaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacacttgtttaggccatctcccatccaatgtgggactcttaaca 35609607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 40717466 - 40717558
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||||||| ||||||||||||||||||||| |||||||| ||| |||||||| | || | | ||||||||||||||||||    
40717466 acaaccccacaaaaccgacttttgaggtgaggattgcccccacttataaacaaattatcaggccaactcccaactgatgtggaactcttaaca 40717558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 400597 - 400682
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||| ||||||| ||||||||||||||||| ||||| | |||| ||||||  ||||||||||    
400597 cacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcagaccatctcatatctgatgtgagactcttaaca 400682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 9685450 - 9685365
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||||||||||| |||||| |||||||| ||||| |||||| | |||| ||||||| | ||||||||||    
9685450 cacaaaaccgacttgtgaggtgaggattggccccacttataaacaaattgttaggccaactcctaaccgatgtaggactcttaaca 9685365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 21685057 - 21684964
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| |||||||| || |||||||||||||||||   ||||| ||||||||||||||||||||||  |||||||||||||  |||||||||||    
21685057 acaaccccacaaaatcggcttgtgaggtgaggatttatcccacttataaacacattgtcaggccatgtcctatccgatgtgagactcttaacag 21684964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 1518223 - 1518131
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||| |||||||||||||||| |||||||| ||||||||| || | |||| ||||||||| |||| |||||    
1518223 acaaccccacaaaaccggcttgtgagctgaggattgcccccacttataaacaaattgtcaggtcaactcctaaccgatgtgggactcataaca 1518131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 5398501 - 5398592
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||||||||| |||||  |||||||||||||| ||||||| || | |||||||||| ||||||||||    
5398501 acaaccccacaaaaccggcttgtgaggtgaggattg-ccccagttataaacacattgttaggccatgacttgtccgatgtgggactcttaaca 5398592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 6218263 - 6218183
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||| ||||||||||| |||||||||||| |||||||||||| |||||||| ||||| | |||||| |||||||||||||    
6218263 acaactccacaaaaccgtcttgtgaggtgaagattgcccccacttataaacatattgtgaagccatctcctatccgatgtg 6218183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 11036536 - 11036628
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| || |||||||| |||||||||||| ||||||||| || |||||||||||||||| | ||||||||||| ||| ||| ||||||||||    
11036536 acaaccccgcaaaaccggcttgtgaggtgatgattgccccaacttataaacacattgtcatgtcatcacctatctgatttgggactcttaaca 11036628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 25052911 - 25052819
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||| ||||| ||||||| |||||||| ||||||||||||   |||| ||||||||| ||||||||||    
25052911 acaaccccacaaaaccggcttgtgaggtgcggattacccccacttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaaca 25052819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 27464273 - 27464361
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||||||||| |||||||||||||||||||| |||| ||||||||| ||||||||  ||| | |||||||||||| ||||||    
27464273 acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacactttgtcaggaaatctcttatccgatgtgggactctt 27464361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 53828314 - 53828406
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| ||  || ||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
53828314 acaaccccacaaaatcggtttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 53828406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 9 - 100
Target Start/End: Complemental strand, 5846204 - 5846113
Alignment:
9 caacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||| ||||||||||| ||| ||||||||||||||||||||| |||||||| |||||||| ||| | |||| ||||||||  ||||||||||    
5846204 caaccccacaaaaccggcttatgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaaccgatgtgagactcttaaca 5846113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 28246110 - 28246169
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtca 67  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||    
28246110 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtca 28246169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 6218488 - 6218406
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||| |||||||||||| |||||||||||| |||||||||||||| ||| |||| |||||| ||||||  ||||||||||    
6218488 aaaaccggcttgtgaggtgatgattgcccccacttataaacacattgttaggtcatctcctatctgatgtgagactcttaaca 6218406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 37836139 - 37836049
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||| ||||||||||| ||||| ||| ||||||||||||||| |||||| ||||||| |||||||  ||| |||||||||| ||||||||    
37836139 acaaccccacaaaaccggcttgtaaggagaggattgcccccacttataaatacattgttaggccatgtcctgtccgatgtgggactcttaa 37836049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 52559626 - 52559565
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcagg 69  Q
    ||||| ||||||||||| |||||||||||| |||||||||||| ||||||||||||||||||    
52559626 acaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcagg 52559565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 9685691 - 9685599
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||| ||||||| ||||||||||||||||||||||||| |||||||| ||||| || ||| | |||| |||||| || ||||||||||    
9685691 acaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgttagaccaactcctaaccgatgcgggactcttaaca 9685599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 72
Target Start/End: Original strand, 12869054 - 12869118
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggcca 72  Q
    ||||| ||||||||||| |||||||||||| |||||||||||| |||||||| ||||||||||||    
12869054 acaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacaaattgtcaggcca 12869118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 17 - 97
Target Start/End: Original strand, 13611783 - 13611863
Alignment:
17 caaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctta 97  Q
    |||||||  |||||||||||||||||  |||||| |||||| | |||||||| ||||||||||||| ||||||||||||||    
13611783 caaaaccaccttgtgaggtgaggattatccccacttataaatatattgtcagaccatcacctatccaatgtggaactctta 13611863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 22231333 - 22231425
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||| | ||| ||||| |||  | |||||||||| | ||||||||||    
22231333 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatatattctcaggtcatatcatatccgatgtaggactcttaaca 22231425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 35797002 - 35797094
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| |  |||||||||||||||||||||||| |||||||| ||||||| | |||| ||| |||||| ||| ||||||||||    
35797002 acaaccccacaaaactggtttgtgaggtgaggattgcccccacttataaacatattgtcatgtcatctcctgtccgatatgggactcttaaca 35797094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 8 - 103
Target Start/End: Original strand, 14783212 - 14783307
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacagaa 103  Q
    ||||| ||||||||||| |||||||||||| |||||||| ||  |||||||| ||||||||  || | |||| ||||||||| |||||||||||||    
14783212 acaaccccacaaaaccggcttgtgaggtgatgattgcccacagttataaacaaattgtcagatcaactcctaaccgatgtgggactcttaacagaa 14783307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 45 - 100
Target Start/End: Complemental strand, 17111790 - 17111735
Alignment:
45 ccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||    
17111790 ccccacttataaacacattgtcaggccatcacctatctgatgtgggactcttaaca 17111735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 980093 - 980167
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||||||| |||||||| ||| ||||| || | |||| ||||||||| ||||||||||    
980093 cttgtgaggtgaggattgcccccacttataaacaaattctcaggtcaactcctaaccgatgtgggactcttaaca 980167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 15 - 89
Target Start/End: Original strand, 7806613 - 7806687
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    |||||||||| |||||||||||||||||||| |||| || ||| |||||||||||||| | |||| |||||||||    
7806613 cacaaaaccggcttgtgaggtgaggattgccgccacttaaaaatacattgtcaggccaactcctaaccgatgtgg 7806687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 16 - 98
Target Start/End: Complemental strand, 35175086 - 35175004
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    |||||| ||||||||||||||| |||| ||||| | ||||||||||||||||||||||   || |||||||||| ||||||||    
35175086 acaaaatcgacttgtgaggtgatgattaccccctcttataaacacattgtcaggccatgttctgtccgatgtgggactcttaa 35175004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 45784921 - 45784995
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||| ||||||| |||| |||||||| | ||||| | ||||||||||||||||||| ||||||||||    
45784921 cttgtgaggtgatgattgccgccacttataaacatactgtcaagtcatcacctatccgatgtgggactcttaaca 45784995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 10 - 100
Target Start/End: Original strand, 54055060 - 54055149
Alignment:
10 aacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||| | |||||||| |||||||||||||||| |||||||| ||||| |||||| |  ||| ||||||||| ||||||||||    
54055060 aacaccacaaaacgg-cttgtgagatgaggattgcccccacttataaacaaattgttaggccaacttctaaccgatgtgggactcttaaca 54055149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 26549696 - 26549615
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgc-ccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||||||||||||||| |||||||| | |||||| | |||||| ||||||||||| ||||||||||| | |||||||||||    
26549696 acaacaccacaaaaccggcttgtgagataaggattactccccacttataaacacatcgtcaggccatctcttatccgatgtg 26549615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 16 - 89
Target Start/End: Complemental strand, 52559855 - 52559782
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    ||||||||| ||||||||||||| ||||| ||||| |||||||||||||||| | |||  ||||||||||||||    
52559855 acaaaaccggcttgtgaggtgagaattgctcccacttataaacacattgtcaagtcatgtcctatccgatgtgg 52559782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 16 - 88
Target Start/End: Original strand, 2221001 - 2221073
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||  | |||||||| | |||| ||||||    
2221001 acaaaaccggcttgtgaggtgaggattgcccccacctataaacacatatttaggccatctcttatctgatgtg 2221073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 5398237 - 5398328
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||| ||||||||| |||| | ||||||||||||||||| |||| || | ||| |||||| ||||||||||    
5398237 acaaccccacaaaaccggcttgtgagatgaggattg-cccctcttataaacacattgtcagaccatgacttgtccaatgtgggactcttaaca 5398328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 28 - 100
Target Start/End: Original strand, 13555292 - 13555364
Alignment:
28 tgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||  ||||  ||||| ||| |||||| |||||| ||||||||||||||||||||||||    
13555292 tgtgaggtgaggattgcatccactcataaatacagtgtcagaccatcatctatccgatgtggaactcttaaca 13555364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 2463865 - 2463803
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggc 70  Q
    ||||| ||||||||||| |||||||||| |||||||||||||| |||| ||| ||||||||||    
2463865 acaaccccacaaaaccggcttgtgaggtaaggattgcccccacttatacacaaattgtcaggc 2463803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 14 - 96
Target Start/End: Complemental strand, 7926381 - 7926299
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||||||||| ||||||  ||||||| ||||||||| |||||||||||  ||||||||||   | |||||||||||||||||    
7926381 ccacaaaaccggcttgtgttgtgaggaatgcccccacttataaacacatgttcaggccatcttttgtccgatgtggaactctt 7926299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 14 - 72
Target Start/End: Original strand, 53814705 - 53814763
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggcca 72  Q
    ||||||||||| |||||||||||||||||  |||||| |||||||| ||||||||||||    
53814705 ccacaaaaccggcttgtgaggtgaggattatccccacttataaacaaattgtcaggcca 53814763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 6778694 - 6778779
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacat-ataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| |||||||||||||||||| | || | | |||||| ||||||||||||||  | |||||||||||| ||||||||||    
6778694 acaaaaccggcttgtgaggtgaggattgtctcctctttataaactcattgtcaggccatgtcatatccgatgtgggactcttaaca 6778779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 13637448 - 13637363
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaact 93  Q
    ||||| |||||||||| | |||||| |||| ||||||||| || |||||||||||||||| | |||| | ||| ||||||||||||    
13637448 acaaccccacaaaaccaaattgtgaagtgaagattgcccctacttataaacacattgtcaagtcatctcttattcgatgtggaact 13637363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 27 - 72
Target Start/End: Complemental strand, 16066105 - 16066060
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggcca 72  Q
    |||||||||||||||||||||||| |||||||| ||||||||||||    
16066105 ttgtgaggtgaggattgcccccacttataaacaaattgtcaggcca 16066060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 34358055 - 34358116
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcagg 69  Q
    ||||| ||||||||||| ||| ||| ||||||||||||||||  ||||||||||||||||||    
34358055 acaaccccacaaaaccggcttctgatgtgaggattgcccccatttataaacacattgtcagg 34358116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 36685900 - 36685961
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcagg 69  Q
    ||||| ||||||||| ||||||||||||||||||  ||||||  ||||||||||||||||||    
36685900 acaaccccacaaaactgacttgtgaggtgaggataacccccatttataaacacattgtcagg 36685961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 18528250 - 18528334
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| ||| ||||||||||||||||||| |||| ||||||||||||| || |||||| | |||  ||||||  ||||||||||    
18528250 acaaaatcgatttgtgaggtgaggattgccgccacttataaacacattgccatgccatctcgtatttgatgtgagactcttaaca 18528334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 35609736 - 35609788
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    ||||| ||||||||||| |||||||||||||||||| |||||| |||||||||    
35609736 acaaccccacaaaaccggcttgtgaggtgaggattggccccacttataaacac 35609788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 54054830 - 54054922
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| || ||| ||||||||| ||||||||||| |||||||| ||||| ||| || | ||||  |||||||| ||||||||||    
54054830 acaaccccacaaaaacggcttatgaggtgagaattgcccccacttataaacaaattgttaggtcaactcctaatcgatgtgggactcttaaca 54054922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Original strand, 17222685 - 17222727
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaac 58  Q
    ||||||||| ||||||||||||||||||||||||| |||||||    
17222685 acaaaaccggcttgtgaggtgaggattgcccccacttataaac 17222727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 101
Target Start/End: Original strand, 18528489 - 18528575
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||||||||| |||||||||||||||||||||||  | | ||||||||||||  | ||| ||| |||||||||  ||| |||||||    
18528489 cacaaaaccgatttgtgaggtgaggattgcccccaattgttaacacattgtcacactatctcctgtccgatgtgagacttttaacag 18528575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 73
Target Start/End: Original strand, 12869288 - 12869353
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    ||||| ||||||||||| ||| |||||||||||||| |||||| |||||| | ||||||| |||||    
12869288 acaaccccacaaaaccgtcttatgaggtgaggattgtccccacttataaataaattgtcaagccat 12869353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 14 - 59
Target Start/End: Complemental strand, 25715946 - 25715901
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaaca 59  Q
    |||||||||||||||||||||||| ||||| ||| |||||||||||    
25715946 ccacaaaaccgacttgtgaggtgatgattgaccctacatataaaca 25715901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 9 - 74
Target Start/End: Original strand, 41187958 - 41188023
Alignment:
9 caacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    |||| |||||||||| |||||||||||||||||||||   || |||||| |||||||||| |||||    
41187958 caaccccacaaaaccaacttgtgaggtgaggattgcctttacttataaatacattgtcagaccatc 41188023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 12005501 - 12005545
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaaca 59  Q
    |||||||||| ||||||||||||||||||||||||| ||| ||||    
12005501 cacaaaaccggcttgtgaggtgaggattgcccccacttattaaca 12005545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 25323823 - 25323875
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    ||||| ||||||||||| | || |||||||||||||||||||| |||||||||    
25323823 acaaccccacaaaaccggcctgcgaggtgaggattgcccccacgtataaacac 25323875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 25324058 - 25324110
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    ||||| |||||||| |||||||||||||||  ||||||||||| |||||||||    
25324058 acaaccccacaaaatcgacttgtgaggtgataattgcccccacttataaacac 25324110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 32 - 100
Target Start/End: Original strand, 40717255 - 40717323
Alignment:
32 aggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||| |||||| |||||||||||||||||| |||   || || ||||||| ||||||||||    
40717255 aggtgaggattgtccccacttataaacacattgtcaggtcatgttctgtctgatgtgggactcttaaca 40717323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 62
Target Start/End: Original strand, 9908863 - 9908910
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||| ||||||||||||| ||| ||||| |||||||||||||||||||    
9908863 cacagaaccgacttgtgatgtggggatttcccccacatataaacacat 9908910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 9 - 60
Target Start/End: Original strand, 42684819 - 42684870
Alignment:
9 caacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    |||| ||||||||||| |||||||||||| |||||||||||  |||||||||    
42684819 caacgccacaaaaccggcttgtgaggtgatgattgcccccatttataaacac 42684870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 102
Target Start/End: Original strand, 11783817 - 11783911
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacaga 102  Q
    ||||| |||||||||| | |||||||||||||||| |||| || |||||||| ||||| | | |||   |||| |||||||  ||||||||||||    
11783817 acaaccccacaaaaccaatttgtgaggtgaggattacccctacttataaacaaattgtaaagtcattttctattcgatgtgagactcttaacaga 11783911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 21646290 - 21646344
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||||| |||||||| | ||||| ||||||||||||||||||  |||||||||||    
21646290 acaacatcacaaaactggcttgtaaggtgaggattgcccccatttataaacacat 21646344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 21646536 - 21646586
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    ||||||||||||| |||||||||||| ||| || | |||||||||||||||    
21646536 aaaaccgacttgtaaggtgaggattgtccctacttgtaaacacattgtcag 21646586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 14 - 88
Target Start/End: Original strand, 21750073 - 21750147
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||||||||| ||||||||||||||| ||| ||||| |||||| | |||||||   |||| | |||||||||||    
21750073 ccacaaaaccggcttgtgaggtgaggaatgctcccacttataaagatattgtcatatcatctcttatccgatgtg 21750147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 42662516 - 42662430
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||  ||||||| |||| |||  ||| |  ||||||||||||||||| ||||| ||||| |||||||| | ||||||||    
42662516 ccacaaaaccggtttgtgagatgagaattatccctatttataaacacattgtcagaccatctcctattcgatgtgggattcttaaca 42662430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 46
Target Start/End: Original strand, 52146090 - 52146128
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccc 46  Q
    ||||| ||||||||||| |||||||||||||||||||||    
52146090 acaaccccacaaaaccggcttgtgaggtgaggattgccc 52146128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 27 - 100
Target Start/End: Original strand, 11103940 - 11104013
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| |||||||||| ||| |  |||||| | |||||||||||| | |||| ||||||||| ||||||||||    
11103940 ttgtgaagtgaggattgtccctatttataaataaattgtcaggccaactcctaaccgatgtgggactcttaaca 11104013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 73
Target Start/End: Complemental strand, 35485286 - 35485221
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    ||||| ||||||||||  | ||| ||||||||| ||||||||| ||||||||||| | ||||||||    
35485286 acaaccccacaaaaccagcgtgtaaggtgaggactgcccccacttataaacacatagccaggccat 35485221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 27 - 68
Target Start/End: Complemental strand, 53699067 - 53699026
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    |||||||||||||||||||| ||| |||||||| ||||||||    
53699067 ttgtgaggtgaggattgcccacacttataaacatattgtcag 53699026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 28 - 72
Target Start/End: Original strand, 2261798 - 2261842
Alignment:
28 tgtgaggtgaggattgcccccacatataaacacattgtcaggcca 72  Q
    |||||||||||||||| |||||| |||||| | ||||||||||||    
2261798 tgtgaggtgaggattgtccccacttataaataaattgtcaggcca 2261842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 6666225 - 6666277
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    ||||| ||||||||||   |||||||||||||||||||||||  |||||||||    
6666225 acaaccccacaaaacctgtttgtgaggtgaggattgcccccaattataaacac 6666277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 32 - 100
Target Start/End: Complemental strand, 17111598 - 17111531
Alignment:
32 aggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||| || ||||||| || |||  | |||||||||||||||| || |||||||||||    
17111598 aggtgaggattgcccc-acttataaactcactgtaggaccatcacctatccgatatgaaactcttaaca 17111531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 20726859 - 20726903
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||| |||||  |||||||||||||||||||| |||||||||||    
20726859 aaaactgactttggaggtgaggattgcccccacttataaacacat 20726903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 22445511 - 22445471
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccccc 48  Q
    ||||| |||||||||||||||||  ||||||||||||||||    
22445511 acaaccccacaaaaccgacttgtagggtgaggattgccccc 22445471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 24513395 - 24513431
Alignment:
19 aaaccgacttgtgaggtgaggattgcccccacatata 55  Q
    |||||| ||||||||||||||||||||||||| ||||    
24513395 aaaccggcttgtgaggtgaggattgcccccacttata 24513431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 73; Significance: 4e-33; HSPs: 85)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 35038219 - 35038311
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||    
35038219 acaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca 35038311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 35038453 - 35038545
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||  ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||    
35038453 acaaccccacaaaaccagcttgtcaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca 35038545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 20327639 - 20327731
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||  |||||||||||||| | ||||||||    
20327639 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcctatccgatgtgggattcttaaca 20327731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 20327874 - 20327966
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
20327874 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 20327966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 16239644 - 16239558
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||||  |||||||||||||  ||||||||||    
16239644 ccacaaaaccggcttgtgaggtgaggtttgcccccacttataaacacattgtcaggccatgtcctatccgatgtgagactcttaaca 16239558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 54567951 - 54567858
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||  |||||||||| | | |||||||||||    
54567951 acaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcaggccatgtcctatccgatataggactcttaacag 54567858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 11589844 - 11589752
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||  ||||||||||    
11589844 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca 11589752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 16926974 - 16927066
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||| |||||||| ||||||| ||||||||||||||||||||||   ||||||||||||| ||||||||||    
16926974 acaaccccacaaaaccggcttgtgagatgaggattacccccacttataaacacattgtcaggccatgttctatccgatgtgggactcttaaca 16927066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 54368575 - 54368483
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||| ||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||  ||||| ||||||| ||||||||||    
54368575 acaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacacattttcaggccatcttctatcggatgtgggactcttaaca 54368483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 39683298 - 39683385
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacat-ataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||||||||||||||||||| |||| | ||||||||||||||||| ||||| ||||||||||||| ||||||||||    
39683298 ccacaaaaccgtcttgtgaggtgaggattgcctccactttataaacacattgtcaggtcatcatctatccgatgtgggactcttaaca 39683385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 14 - 88
Target Start/End: Original strand, 50083112 - 50083186
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||||||||| ||||||||||||||||| ||||||| ||||||||||||||| ||||||||| |||||||||||    
50083112 ccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcgggccatcacttatccgatgtg 50083186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 22729152 - 22729067
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||| ||||||||||||||||| | ||||||||||||||| ||||| |||||||||||||| ||||| ||||    
22729152 cacaaaaccggcttgtgaagtgaggattgcccccacttgtaaacacattgtcagaccatctcctatccgatgtgggactctgaaca 22729067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 23691224 - 23691309
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||||||||||| |||||||| |||||||||| | | |||| ||||||||| ||||||||||    
23691224 cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca 23691309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 23708024 - 23708109
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||||||||||| |||||||| |||||||||| | | |||| ||||||||| ||||||||||    
23708024 cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca 23708109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 23726480 - 23726565
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||||||||||| |||||||| |||||||||| | | |||| ||||||||| ||||||||||    
23726480 cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca 23726565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 23744936 - 23745021
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||||||||||| |||||||| |||||||||| | | |||| ||||||||| ||||||||||    
23744936 cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca 23745021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 24063461 - 24063546
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||||||||||| |||||||| |||||||||| | | |||| ||||||||| ||||||||||    
24063461 cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca 24063546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 38791475 - 38791568
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| |||||||| ||| ||||||||||||||||| || ||| |||||| |||||||||| ||||| |||||||||||||| |||||||||||    
38791475 acaaccccacaaaatcgatttgtgaggtgaggattgtcctcacttataaatacattgtcagaccatctcctatccgatgtgggactcttaacag 38791568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 45138827 - 45138908
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||| ||||| | ||||||||||||    
45138827 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgccagaccatctcttatccgatgtgg 45138908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 1723101 - 1723192
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| |  ||| ||||||||| ||||||||||    
1723101 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaac-tctaaccgatgtgggactcttaaca 1723192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 20303095 - 20303181
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||  |||||||||||||||||||||||| |||||| |||||||||||||||  | |||||||||||| | ||||||||    
20303095 ccacaaaaccggtttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcatatccgatgtgggattcttaaca 20303181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 6487357 - 6487450
Alignment:
7 aacaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| ||| ||||||| ||||||||||||||||| || |||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
6487357 aacaaccccataaaaccggcttgtgaggtgaggattacctccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 6487450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 30138111 - 30138046
Alignment:
20 aaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgat 85  Q
    ||||| ||| ||||||||||||||||||||| |||||||||||| |||||||||||||||||||||    
30138111 aaccggcttatgaggtgaggattgcccccacttataaacacattatcaggccatcacctatccgat 30138046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 30147662 - 30147597
Alignment:
20 aaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgat 85  Q
    ||||| ||| ||||||||||||||||||||| |||||||||||| |||||||||||||||||||||    
30147662 aaccggcttatgaggtgaggattgcccccacttataaacacattatcaggccatcacctatccgat 30147597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 45138996 - 45139077
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||| ||||| ||||||||||||| | |||| |||||||    
45138996 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttattaacacgttgtcaggccatctcttatcagatgtgg 45139077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 4155383 - 4155291
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||| ||||||||||||||||||||| |||||||||  |||| ||||||  | |||||||||||| ||||||||||    
4155383 acaaccccacaaaaccggcttttgaggtgaggattgcccccacttataaacacgctgtctggccatgtcatatccgatgtgggactcttaaca 4155291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 8019027 - 8018935
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||| ||||| |||||||| ||| |||||||| |  ||| ||||||||| ||||||||||    
8019027 acaaccccacaaaaccggcttgtgaggtgaggattgcacccacttataaacaaattttcaggccaacttctaaccgatgtgggactcttaaca 8018935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 16239886 - 16239794
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||||||||||||||||||  |||||||||| |||||||| |||||||||||||  ||||||||  |||  ||||||||||    
16239886 acaaccccacaaaaccgacttgtgaggtgagatttgcccccacttataaacatattgtcaggccatgtcctatccgtcgtgtgactcttaaca 16239794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 17638293 - 17638202
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| || |||||||  |||||||||||||||||||||| || |||||||| |||||||||||| | |||| ||||||||||||||||||||    
17638293 acaacccctcaaaaccagcttgtgaggtgaggattgcccc-acttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaaca 17638202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 16 - 96
Target Start/End: Original strand, 30179741 - 30179821
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||||| ||||||||||||||||||| ||||||| |||||||||||||||||| |||| | |||| ||||||| ||||||    
30179741 acaaaactgacttgtgaggtgaggattacccccacttataaacacattgtcaggtcatctcttatctgatgtgggactctt 30179821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 39620385 - 39620293
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| | ||| ||||||| || || ||||||| |||||||||||||||||| ||||||||||||||||||  ||||||||||    
39620385 acaaccccacaaaactggcttatgaggtgcgggttacccccacttataaacacattgtcaggtcatcacctatccgatgtgagactcttaaca 39620293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 49629664 - 49629573
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||||  |||||||||| |||||||| |||| |||||||||||| ||| |||||| ||||||| |||||||||||||||||    
49629664 acaaccccacaaaaccggtttgtgaggtggggattgccgccacttataaacacattttca-gccatctcctatccaatgtggaactcttaaca 49629573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 8 - 79
Target Start/End: Original strand, 472085 - 472156
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcaccta 79  Q
    ||||| ||||||||||| |||||||||| |||||||||||||| |||||||||||||||| |||||| ||||    
472085 acaaccccacaaaaccggcttgtgaggtaaggattgcccccacttataaacacattgtcaagccatctccta 472156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 41 - 100
Target Start/End: Complemental strand, 34992576 - 34992517
Alignment:
41 ttgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||||||    
34992576 ttgcccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaaca 34992517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 100
Target Start/End: Complemental strand, 39269381 - 39269298
Alignment:
17 caaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||   || ||| |||||| ||||||||||    
39269381 caaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtgctctccaatgtgggactcttaaca 39269298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 4155608 - 4155526
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||| ||| |||||||||||||| |||||| |||||||||||||||||||| |  ||||| |||||||| ||||||||||    
4155608 aaaaccggcttttgaggtgaggattgtccccacttataaacacattgtcaggccttgtcctatgcgatgtgggactcttaaca 4155526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 16 - 98
Target Start/End: Original strand, 21809180 - 21809262
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||||||| ||||||||||| ||||||||||||| |||||  | |||||||| |||||| ||||||||||||| ||||||||    
21809180 acaaaaccggcttgtgaggtgtggattgcccccacttataattatattgtcagaccatcagctatccgatgtggcactcttaa 21809262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 18757901 - 18757820
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    ||||| ||||||||||| ||||||| |||||||| |||||||| ||||||||||| |||||| || | ||||||||||||||    
18757901 acaaccccacaaaaccgccttgtgatgtgaggatcgcccccacttataaacacatagtcaggtcaactcctatccgatgtgg 18757820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 23708256 - 23708341
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||||||||||| |||||||| |||||||| | | | |||| | ||||||| ||||||||||    
23708256 cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagactaactcctaactgatgtgggactcttaaca 23708341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 23726712 - 23726797
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||||||||||| |||||||| |||||||| | | | |||| | ||||||| ||||||||||    
23726712 cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagactaactcctaactgatgtgggactcttaaca 23726797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 23745168 - 23745253
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||||||||||| |||||||| |||||||| | | | |||| | ||||||| ||||||||||    
23745168 cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcagactaactcctaactgatgtgggactcttaaca 23745253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 8 - 72
Target Start/End: Complemental strand, 34610620 - 34610555
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgc-ccccacatataaacacattgtcaggcca 72  Q
    ||||| ||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||    
34610620 acaaccccacaaaaccgacttgtgaggtgaggattgccccccacttataaacatattgtcaggcca 34610555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 7697423 - 7697514
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||  |||||||||||| |||||||||||| ||| |||| |||||| || |||| |||||||||||||| ||||||||||    
7697423 acaaccccacaaaaccagcttgtgaggtgatgattgcccccacttat-aacatattgtctggtcatctcctatccgatgtgggactcttaaca 7697514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 9273020 - 9272928
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||||| |||||||||| |||||||| ||| ||||||||   |||| ||||||||  ||||||||||    
9273020 acaaccccacaaaaccggcttgtgaggtgagggttgcccccacttataaacaaattatcaggccaattcctaaccgatgtgagactcttaaca 9272928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 9273254 - 9273162
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||  ||||||| ||||||||||||||||| |||||||| |||||||| |||   |||| ||||||||| ||||||||||    
9273254 acaaccccacaaaaccagcttgtgaagtgaggattgcccccacttataaacaaattgtcagaccaattcctaaccgatgtgggactcttaaca 9273162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 12930153 - 12930233
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||| ||||||||||| ||||||| ||||| |||| |||||||||| |||||||||||||| |||| | |||||||||||    
12930153 acaaccccacaaaaccggcttgtgaagtgagaattgtccccacatatgaacacattgtcaggtcatctcttatccgatgtg 12930233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 14839770 - 14839854
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||| | |||||||||||||| || |||||| ||||| |||| |||||| ||||| |||||| |||||||||||    
14839770 acaaaaccgacttgtaacgtgaggattgccccaacttataaatacattatcagaccatcaactatctgatgtgaaactcttaaca 14839854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 26 - 98
Target Start/End: Complemental strand, 54368763 - 54368691
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    |||||||||||||||||||| |||| |||||| ||||||||||||||||  ||||||||||| | ||||||||    
54368763 cttgtgaggtgaggattgccaccacttataaatacattgtcaggccatcttctatccgatgttggactcttaa 54368691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 31317281 - 31317196
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||||||||||||||||| |||||| ||||||||||||| || || ||  | |||||||||||| ||||||||||    
31317281 ccacaaaaccggcttgtgaggtgaggattg-ccccacttataaacacattgccatgctatgtcttatccgatgtgggactcttaaca 31317196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 24063693 - 24063746
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    |||||||||| ||||||||||||||||||||||||| |||||||| ||||||||    
24063693 cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcag 24063746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 27086649 - 27086554
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataa---acacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||| |||||| || |||||||||  | ||| |||||   ||||||||||||||||||||||||| ||||||| ||||||||||    
27086649 acaactccacaaaaccaacttgtaagatgaggattgtactcacttataataaacacattgtcaggccatcacctatctgatgtgggactcttaaca 27086554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 27670417 - 27670509
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| | | ||||||||||||||||||||| ||||||||  |||||||||||   |||  ||||||||| ||||||||||    
27670417 acaaccccacaaaaccggcctttgaggtgaggattgcccccacttataaacaatttgtcaggccaattcctgaccgatgtgggactcttaaca 27670509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 13 - 100
Target Start/End: Complemental strand, 17638461 - 17638375
Alignment:
13 accacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||| ||||||| |||||||| ||||||||||||| || |||||||| |||||||||||| |  ||| ||||||||| ||||||||||    
17638461 accataaaaccggcttgtgagatgaggattgcccc-acttataaacaaattgtcaggccagcttctaaccgatgtgggactcttaaca 17638375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 1800274 - 1800208
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    ||||| |||||||||||  |||||||||||||||||||||||| |||||| ||| |||||| |||||    
1800274 acaaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaatacactgtcagaccatc 1800208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 3975389 - 3975475
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| || |||| ||||||| ||||  |||||| ||||||||||||||||||  ||||||||||||||| |  ||||||||||    
3975389 ccacaaaatcggcttgagaggtgatgattatccccacttataaacacattgtcaggttatcacctatccgatgcgtgactcttaaca 3975475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 17001452 - 17001538
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| || ||| |||||||| |||||||||||| ||||||||||||||||| | | | |||||||||| ||  ||||||||||    
17001452 ccacaaaatcgccttatgaggtgatgattgcccccacttataaacacattgtcagacgaactcctatccgatatgtgactcttaaca 17001538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 16 - 74
Target Start/End: Complemental strand, 43781634 - 43781576
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    ||||||||||||||||| |||||||||||| |||| ||||||| |||||||||| ||||    
43781634 acaaaaccgacttgtgaagtgaggattgcctccacttataaactcattgtcaggtcatc 43781576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 50930761 - 50930707
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||| |||||||||||  |||||||||||||||||||||||| |||||||||||    
50930761 acaaccccacaaaaccgttttgtgaggtgaggattgcccccacttataaacacat 50930707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 23691456 - 23691509
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    |||||| ||| ||||||||||||||||||||||||| |||||||| ||||||||    
23691456 cacaaatccggcttgtgaggtgaggattgcccccacttataaacaaattgtcag 23691509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 31317525 - 31317433
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| || ||||| || |||||||||||| ||||  |||||| |||||||||||||||| | |||  |||||||||||| | ||||||||||    
31317525 acaaccccgcaaaatcggcttgtgaggtgatgattttccccacttataaacacattgtcatgtcatgtcctatccgatgtaggactcttaaca 31317433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 45828305 - 45828217
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||||||||  |||||||||||  |||||||||||| |||||||||||  ||||||||||   | |||||||||| ||||||    
45828305 acaaccccacaaaacctgcttgtgaggtggagattgcccccacttataaacacatgttcaggccatcttttgtccgatgtgggactctt 45828217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 87
Target Start/End: Complemental strand, 2805416 - 2805342
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgccccc-acatataaacacattgtcaggccatcacctatccgatgt 87  Q
    |||||||||| |||| ||||||||| ||||||||| || |||||||||||||| || ||||| | ||||||||||    
2805416 ccacaaaaccaacttatgaggtgagaattgccccccacttataaacacattgttagaccatctcatatccgatgt 2805342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 13574946 - 13575000
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||| ||||||||| | ||||||||||||||||| ||||||| |||||||||||    
13574946 acaaccccacaaaactggcttgtgaggtgaggatttcccccacttataaacacat 13575000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 33205524 - 33205458
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    ||||| || |||||| | |||||||||||||||||||||  ||||||||||||||  ||||||||||    
33205524 acaaccccgcaaaactggcttgtgaggtgaggattgcccttacatataaacacatgttcaggccatc 33205458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 73
Target Start/End: Original strand, 50052564 - 50052630
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattg-cccccacatataaacacattgtcaggccat 73  Q
    ||||| ||||||||||| ||||||| |||||||||| ||||||| ||||||||||| ||| ||||||    
50052564 acaaccccacaaaaccggcttgtgaagtgaggattgccccccacttataaacacatggtcgggccat 50052630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 31 - 100
Target Start/End: Complemental strand, 4008721 - 4008652
Alignment:
31 gaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||| |||  ||||||  |||||||| |||||||||||||||||||||||||| |  ||||||||||    
4008721 gaggtgatgatcacccccatttataaacatattgtcaggccatcacctatccgatgcgagactcttaaca 4008652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 80
Target Start/End: Original strand, 13741126 - 13741199
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgagga-ttgcccccacatataaacacattgtcaggccatcacctat 80  Q
    ||||| ||| ||||||| ||||||||||||||| ||| |||||| ||||||||||||||||  ||||| |||||    
13741126 acaaccccaaaaaaccggcttgtgaggtgaggatttgtccccacttataaacacattgtcaaaccatctcctat 13741199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 28087246 - 28087336
Alignment:
14 ccacaaaaccgacttgtgaggtgaggatt----gcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||||||||||| ||||    |||||||| |||||||| ||||| |||||| | |||| ||||||||  ||||||||||    
28087246 ccacaaaaccggcttgtgaggtgatgattaattgcccccacttataaacaaattgttaggccaactcctaaccgatgtgagactcttaaca 28087336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 52 - 100
Target Start/End: Complemental strand, 34992857 - 34992808
Alignment:
52 tataaacacatt-gtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||| ||||| |||||||||||||||||||| ||||||||||    
34992857 tataaacacatttgtcagaccatcacctatccgatgtgggactcttaaca 34992808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 24 - 100
Target Start/End: Complemental strand, 2123850 - 2123774
Alignment:
24 gacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| |||||||||||||||| ||| |||||||||||| ||||  |||  ||||||||| |||  ||||||||||    
2123850 gacttgcgaggtgaggattgccctcacttataaacacattatcagatcatgtcctatccgacgtgagactcttaaca 2123774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 15 - 59
Target Start/End: Complemental strand, 45828071 - 45828027
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaaca 59  Q
    |||||||||| |||||||||||||||||||||| || ||||||||    
45828071 cacaaaaccggcttgtgaggtgaggattgccccaacttataaaca 45828027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 18 - 73
Target Start/End: Original strand, 50052800 - 50052856
Alignment:
18 aaaaccgacttgtgaggtgaggattgc-ccccacatataaacacattgtcaggccat 73  Q
    ||||||| ||||||||| ||||||||| |||||| ||||||||||| ||||||||||    
50052800 aaaaccggcttgtgaggcgaggattgcaccccacttataaacacatggtcaggccat 50052856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 74
Target Start/End: Complemental strand, 20479060 - 20479001
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    ||||||| || ||||||||||||||||| ||||||| |||||||| ||  ||||||||||    
20479060 cacaaaaacggcttgtgaggtgaggatttcccccacttataaacatatgttcaggccatc 20479001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 19 - 98
Target Start/End: Original strand, 29575926 - 29576005
Alignment:
19 aaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    |||||||||||||| ||||  |||| || ||| |||||||||||| ||||| |||| | |||||||||||  ||||||||    
29575926 aaaccgacttgtgatgtgataattgtcctcacttataaacacattctcaggtcatctcttatccgatgtgagactcttaa 29576005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 27 - 62
Target Start/End: Complemental strand, 41915211 - 41915176
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||||||||||||||||||||||| |||||||||||    
41915211 ttgtgaggtgaggattgcccccacttataaacacat 41915176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 14991924 - 14991878
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||||| ||||||||  ||||||||||||||||| |||||||||||    
14991924 acaaaactgacttgtggagtgaggattgcccccacttataaacacat 14991878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 15 - 73
Target Start/End: Original strand, 17001274 - 17001332
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    ||||||||||  || ||| ||||||||||| ||||| ||||| ||||||||||||||||    
17001274 cacaaaaccgttttatgaagtgaggattgctcccacttataatcacattgtcaggccat 17001332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 14611235 - 14611194
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccccca 49  Q
    ||||| |||| |||||| ||||||||||||||||||||||||    
14611235 acaactccactaaaccggcttgtgaggtgaggattgccccca 14611194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 59 - 100
Target Start/End: Complemental strand, 20303054 - 20303013
Alignment:
59 acattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||  |||||||||||||| ||||||||||    
20303054 acattgtcaggccatgtcctatccgatgtgggactcttaaca 20303013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 45
Target Start/End: Complemental strand, 24866256 - 24866219
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcc 45  Q
    ||||| ||||||||||| ||||||||||||||||||||    
24866256 acaaccccacaaaaccggcttgtgaggtgaggattgcc 24866219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 27 - 68
Target Start/End: Complemental strand, 33640321 - 33640280
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    ||||||||||| ||||| |||||| |||||||||||||||||    
33640321 ttgtgaggtgaagattgtccccacttataaacacattgtcag 33640280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 14 - 55
Target Start/End: Complemental strand, 46794287 - 46794246
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatata 55  Q
    |||||||||||||||||  |||||||||||||||||| ||||    
46794287 ccacaaaaccgacttgtagggtgaggattgcccccacttata 46794246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 14 - 62
Target Start/End: Original strand, 2806317 - 2806365
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||||||| | ||||||||||||||||| | ||||| |||||||||||    
2806317 ccacaaaactggcttgtgaggtgaggattccacccacttataaacacat 2806365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 23610396 - 23610448
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    ||||| ||||||||||| | |||||| |||||||| ||||||| |||||||||    
23610396 acaaccccacaaaaccggcctgtgagttgaggattacccccacttataaacac 23610448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 52724019 - 52724103
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| ||| || |||||||||||||||||| |  |||||||| ||||| ||   |||  ||||||||||||| ||||||||||    
52724019 acaaaatcgatttatgaggtgaggattgccccaatttataaacatattgttagattatcttctatccgatgtgggactcttaaca 52724103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 69; Significance: 9e-31; HSPs: 97)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 21054978 - 21055070
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||| ||||||||||    
21054978 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattgtcaggccatcacctatccgatatgggactcttaaca 21055070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 47710502 - 47710409
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||| | ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||  |||||||||||    
47710502 acaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtaaggccatcacctatccgatgtgagactcttaacag 47710409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 47722158 - 47722065
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||| | ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||  |||||||||||    
47722158 acaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtaaggccatcacctatccgatgtgagactcttaacag 47722065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 29469664 - 29469571
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||  ||| |||||||||| |||||||||||    
29469664 acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacag 29469571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 2544472 - 2544564
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| | |||| |||| |||| ||||||||||    
2544472 acaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgacgtgggactcttaaca 2544564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 21861588 - 21861496
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| || ||||| ||||||||||||||||||| ||||||||||||||||||||||  ||| |||||||||||||||||||||    
21861588 acaaccccacaaaatcggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtggaactcttaaca 21861496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 26239941 - 26240033
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||  |||||||||||| | ||||||||||    
26239941 acaaccccacaataccgacttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatccgatgtcggactcttaaca 26240033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 29469899 - 29469807
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||  ||| |||||||||| ||||||||||    
29469899 acaactccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca 29469807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 48243086 - 48243176
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||  |||| ||||||| ||||||||||    
48243086 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatca--tatctgatgtgggactcttaaca 48243176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 48661587 - 48661672
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||||||||||| |||||| ||||||||||| |||| |||||| ||||||| ||||||||||    
48661587 cacaaaaccggcttgtgaggtgaggattgcccccacctataaatacattgtcaggtcatctcctatctgatgtgggactcttaaca 48661672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 3393041 - 3392949
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| || ||||||||||||| |||  |||||| |||||||||||||||||||||||||||||||||||||  ||||||||||    
3393041 acaaccccacaaaatcggcttgtgaggtgagaattttccccacttataaacacattgtcaggccatcacctatccgatgtgagactcttaaca 3392949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 9689123 - 9689207
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| ||||||||||||||||| ||||||| ||||| ||||||||||  |||||||||||||||||||| ||||||||||    
9689123 acaaaaccggcttgtgaggtgaggatttcccccacttataagcacattgtcaaaccatcacctatccgatgtgggactcttaaca 9689207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 34027452 - 34027360
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||| | ||||||||    
34027452 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggattcttaaca 34027360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 36277251 - 36277343
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||  | | |||||||||  ||||||||||    
36277251 acaaccccacaaaatcgacttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcttgtccgatgtgagactcttaaca 36277343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 48243462 - 48243554
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||| || |||||||||||||||| ||||||||||||||||||||||||| ||| | |||||| ||||||||||    
48243462 acaaccccacaaaaccggcttgtaagatgaggattgcccccacttataaacacattgtcaggccatcacatattcaatgtgggactcttaaca 48243554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 14 - 101
Target Start/End: Complemental strand, 21861347 - 21861260
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||||||  ||| |||||||||| |||||||||||    
21861347 ccacaaaaccggcttgtaaggtgaggattgccctcacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacag 21861260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 2404209 - 2404291
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||| ||| |||||||||||||| ||||||||||||||||| ||||| |||| ||||||||| ||||||||||    
2404209 aaaaccgacttgtggggttaggattgcccccacttataaacacattgtcagtccatctcctaaccgatgtgggactcttaaca 2404291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 34 - 100
Target Start/End: Original strand, 3519776 - 3519842
Alignment:
34 gtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||    
3519776 gtgaggattacccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca 3519842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 3520075 - 3520145
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||||| |||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||    
3520075 aaaaccggcttgcgaggtgaggattgcccccacttataaacacattgtcagaccatcacctatccgatgtg 3520145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 33996336 - 33996426
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||| |||||||||||||||||||||||| |||||||||||| |||||| ||||| | |||||||  |||||||||||||| ||||||||    
33996336 acaactccacaaaaccgacttgtgaggtgaagattgcccccacttataaatacattattaggccatgtcctatccgatgtgggactcttaa 33996426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 42985155 - 42985240
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||| ||||||||||||||||||||||| |||| ||||||||||||||||  ||||||| |||||||||||  ||||||||||    
42985155 cacaaaatcgacttgtgaggtgaggattgcctccacttataaacacattgtcaaaccatcacatatccgatgtgagactcttaaca 42985240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 43688195 - 43688276
Alignment:
19 aaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| |||| ||||| |||||||||||||| ||||||||||||||||||||||  |||||||||||||| ||||||||||    
43688195 aaaccggcttgagaggtaaggattgcccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca 43688276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 2404443 - 2404525
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||| ||||||||||||||| || ||||||||||||||||| || || ||||||||| |||| ||||||||||    
2404443 aaaaccgacttgtggggtgaggattgcccctacttataaacacattgtcagtccgtctcctatccgacgtgggactcttaaca 2404525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 26562104 - 26562190
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||||||||||| |||||||||||| |||||||| |||||||||||| | |||| ||||||||  ||||||||||    
26562104 ccacaaaaccggcttgtgaggtgaagattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca 26562190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 8 - 102
Target Start/End: Original strand, 36206088 - 36206182
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacaga 102  Q
    ||||| ||| ||||||| |||||||||||| ||||||| |||| |||||||| ||||| |||||| | |||| ||||||||||||||||||||||    
36206088 acaaccccataaaaccggcttgtgaggtgaagattgcctccacttataaacaaattgttaggccaactcctaaccgatgtggaactcttaacaga 36206182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 1596642 - 1596561
Alignment:
19 aaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| ||||| ||||||||||||||||||| ||| ||||||||||||||||||  ||| |||||||||| ||||||||||    
1596642 aaaccggcttgtaaggtgaggattgcccccacttattaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca 1596561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 25620195 - 25620134
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcagg 69  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||    
25620195 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagg 25620134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 27 - 100
Target Start/End: Original strand, 31485468 - 31485541
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| ||||||||||||||||| ||||||||||||||||||||||||| ||||  |||||| ||||||||||    
31485468 ttgtgatgtgaggattgcccccacttataaacacattgtcaggccatcacatatcttatgtgggactcttaaca 31485541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 46452692 - 46452599
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgc-ccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||| |||||||||||||||||||| |||||| ||||||||||||||  || |||  |||||||||||||| ||||||||||    
46452692 acaaccccacaaaaccaacttgtgaggtgaggattgccccccacttataaacacattgtgtggtcatgtcctatccgatgtgggactcttaaca 46452599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 1596879 - 1596795
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| ||||| ||||||||||||||||||| |||||| ||||||| |||||||  ||| |||||||||| ||||||||||    
1596879 acaaaaccggcttgtaaggtgaggattgcccccacttataaaaacattgttaggccatgtcctgtccgatgtgggactcttaaca 1596795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 3038109 - 3038201
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||| ||||||||||||||||| |||||||||||||| || | ||| | ||| |||||||| ||||||||||    
3038109 acaaccccacaaaaccggcttgtgacgtgaggattgcccccacttataaacacattgttagacaatctcttattcgatgtgggactcttaaca 3038201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 17202238 - 17202146
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||| |||| ||||||||||| |||||||| |||||||||||| | | || ||||||||| ||||||||||    
17202238 acaaccccacaaaaccggcttgtgagatgagaattgcccccacttataaacaaattgtcaggccaactcttaaccgatgtgggactcttaaca 17202146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 34027686 - 34027594
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||| ||||||||||||||||| |||||||| |||||||||||| |  ||| | ||||||| ||||||||||    
34027686 acaaccccacaaaaccggcttgtgaagtgaggattgcccccacttataaacaaattgtcaggccaacttctaactgatgtgggactcttaaca 34027594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 27 - 99
Target Start/End: Original strand, 44874390 - 44874462
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    |||||||||||||||| ||||||| ||||||||||||||||||  ||| |||||||||||||| |||||||||    
44874390 ttgtgaggtgaggatttcccccacttataaacacattgtcaggttatctcctatccgatgtgggactcttaac 44874462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 15 - 82
Target Start/End: Original strand, 31485691 - 31485758
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatcc 82  Q
    |||||||||| ||||| ||||||||||||||||||| |||||| |||||||||||||||||| |||||    
31485691 cacaaaaccggcttgtcaggtgaggattgcccccacttataaaaacattgtcaggccatcacttatcc 31485758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 30 - 100
Target Start/End: Original strand, 6001482 - 6001552
Alignment:
30 tgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||| |||||||| ||||||||| ||||  ||||||||||||| ||||||||||    
6001482 tgaggtgaggattgcccccacttataaacatattgtcaggtcatcttctatccgatgtgggactcttaaca 6001552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 22574658 - 22574572
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||||||||||||| ||||| | ||| |||||||| ||| ||| |||||||| |||||||||||| ||||||||||    
22574658 ccacaaaaccggcttgtgaggtgagaattgctctcacttataaacagattatcaagccatcacatatccgatgtgggactcttaaca 22574572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 31892204 - 31892118
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||||||||||||||||| |||||| |||||| ||||||||| || ||  |||||||||||||| ||| ||||||    
31892204 ccacaaaaccggcttgtgaggtgaggattgtccccacttataaatacattgtcatgctatatcctatccgatgtgggacttttaaca 31892118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 15 - 89
Target Start/End: Original strand, 32278917 - 32278991
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    |||||||||| ||| |||||||| ||||| |||||| ||||||||||||||||| ||||||| ||||||||||||    
32278917 cacaaaaccggcttatgaggtgacgattgtccccacttataaacacattgtcagaccatcacatatccgatgtgg 32278991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 2544240 - 2544332
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| | ||||| |||||| |||||||||||| |||||||| |||||||| ||| | |||| ||||||||| ||||||||||    
2544240 acaaccccacaaaactggcttgtaaggtgaagattgcccccacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca 2544332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 6634914 - 6634822
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||   ||| ||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||  ||||||||||    
6634914 acaaccccacaaaactagcttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca 6634822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 17 - 97
Target Start/End: Complemental strand, 9625463 - 9625383
Alignment:
17 caaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctta 97  Q
    |||||||  |||||||||||||||||  |||||| |||||| | |||||||| ||||||||||||| ||||||||||||||    
9625463 caaaaccaccttgtgaggtgaggattatccccacttataaatatattgtcagaccatcacctatccaatgtggaactctta 9625383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 11211704 - 11211791
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||||||||| |||||||||||||||||| |||||| |||||| ||||||| |||||||| | ||||||| |||| ||||||    
11211704 acaaccccacaaaaccggcttgtgaggtgaggattg-ccccacttataaagacattgttaggccatctcttatccgacgtgggactctt 11211791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 18826513 - 18826605
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| |  |||||||| |||| ||| ||||||| |||||||||||||||||| |||| ||||||| |||||| ||||||||||    
18826513 acaaccccacaaaatcagcttgtgagttgagaattacccccacttataaacacattgtcaggtcatctcctatccaatgtgggactcttaaca 18826605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 16 - 88
Target Start/End: Original strand, 35308179 - 35308251
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    |||||||||| ||||||||||| |||||||||||| |||||||||||||||| | |||| |||||| ||||||    
35308179 acaaaaccgaattgtgaggtgatgattgcccccacttataaacacattgtcatgacatctcctatctgatgtg 35308251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 36993099 - 36993191
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||  ||||||||||||| ||||| || || ||||||||||||||||| ||||  | |||||||||| ||||||||||||    
36993099 acaaccccacaaaaccagcttgtgaggtgagcattgctcctacttataaacacattgtcagaccatgtcatatccgatgttgaactcttaaca 36993191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 8 - 102
Target Start/End: Complemental strand, 10903144 - 10903049
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg-gaactcttaacaga 102  Q
    ||||| ||||||||||| ||||||||||||||||| |||| || |||||||| ||||||| |||||  ||||| ||||||| | ||||||||||||    
10903144 acaactccacaaaaccggcttgtgaggtgaggattacccctacttataaacatattgtcaagccatgtcctattcgatgtgtggactcttaacaga 10903049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 8 - 74
Target Start/End: Original strand, 32879639 - 32879706
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattg-cccccacatataaacacattgtcaggccatc 74  Q
    ||||| || |||||||| |||||||||||||||||| ||||||| |||||||||||||||||||||||    
32879639 acaaccccgcaaaaccggcttgtgaggtgaggattgccccccacttataaacacattgtcaggccatc 32879706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 43075335 - 43075394
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtca 67  Q
    ||||| |||||||||| |||||||||||||||||||||||||| ||||||||| ||||||    
43075335 acaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtca 43075394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 43085562 - 43085621
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtca 67  Q
    ||||| |||||||||| |||||||||||||||||||||||||| ||||||||| ||||||    
43085562 acaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtca 43085621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 43089233 - 43089292
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtca 67  Q
    ||||| |||||||||| |||||||||||||||||||||||||| ||||||||| ||||||    
43089233 acaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtca 43089292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 30 - 100
Target Start/End: Complemental strand, 4267891 - 4267821
Alignment:
30 tgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||| |||||||| |||||||| ||| | |||| ||||||||| ||||||||||    
4267891 tgaggtgaggattgcccccacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca 4267821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 4268103 - 4268021
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||| ||| |||||||| |||||||||||| |||||||| |||||||||||| | |||| | ||||||| ||||||||||    
4268103 aaaaccggcttttgaggtgatgattgcccccacttataaacaaattgtcaggccaactcctaactgatgtgggactcttaaca 4268021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 16 - 74
Target Start/End: Complemental strand, 4454827 - 4454769
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    |||||||||  |||||||||||||||||||||||| ||||||||||||||||| |||||    
4454827 acaaaaccggtttgtgaggtgaggattgcccccacttataaacacattgtcagaccatc 4454769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 14 - 72
Target Start/End: Original strand, 10882036 - 10882094
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggcca 72  Q
    ||||||||||| ||||||||||||||||||||||||| |||||||| ||||||| ||||    
10882036 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcatgcca 10882094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 2315295 - 2315376
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    ||||| ||||||||||| ||| ||||||||| |||||| ||||||||||| |||| ||||| ||||||| ||| ||||||||    
2315295 acaaccccacaaaaccggcttatgaggtgagaattgcctccacatataaatacatagtcagaccatcacatattcgatgtgg 2315376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 26 - 99
Target Start/End: Original strand, 33996122 - 33996195
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    |||||||||||||||||| |||||| ||||||||||||||||| | ||  | |||||||||||| |||||||||    
33996122 cttgtgaggtgaggattgtccccacgtataaacacattgtcagacaatgtcttatccgatgtgggactcttaac 33996195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 40746550 - 40746465
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| | ||||||||||| ||||| ||||||| |||||||| |||||||||||| | |||| || |||||| ||||||||||    
40746550 cacaaaactggcttgtgaggtgtggatttcccccacttataaacaaattgtcaggccaactcctaaccaatgtgggactcttaaca 40746465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 28 - 100
Target Start/End: Original strand, 9688915 - 9688987
Alignment:
28 tgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||  ||||  ||||| ||| |||||| |||||| ||||||||||||||||||||||||    
9688915 tgtgaggtgaggattgcatccactcataaatacagtgtcagaccatcatctatccgatgtggaactcttaaca 9688987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 14 - 99
Target Start/End: Complemental strand, 33834471 - 33834394
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    ||||||||||| |||||||||||| |||||||||||||        ||||||||| |||||||||||||||||||| |||||||||    
33834471 ccacaaaaccggcttgtgaggtgaagattgcccccaca--------cattgtcagaccatcacctatccgatgtgggactcttaac 33834394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 15317611 - 15317546
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    |||||||||||||||    |||||||||||||||||||||||| |||||||||| ||||||||||||    
15317611 acaacaccacaaaactagtttgtgaggtgaggattgcccccacttataaacaca-tgtcaggccatc 15317546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 26 - 100
Target Start/End: Complemental strand, 22574876 - 22574803
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||| ||| |||||| ||||||||| | |||||| |||||||||||  ||||||||||    
22574876 cttgtgaggtgaggattgccctcacttataaa-acattgtcatgtcatcacatatccgatgtgagactcttaaca 22574803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 28080717 - 28080632
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||| ||||  |||||||  || |||||||||||||||||| |||| | |||||||||||  ||||||||||    
28080717 ccacaaaaccgacttgtgaagtgaaaattgccct-acttataaacacattgtcaggtcatctcttatccgatgtgagactcttaaca 28080632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 14 - 96
Target Start/End: Complemental strand, 47849624 - 47849542
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    |||||||||||  ||||||||||||||||||||| || |||||||||||  ||| ||||||   |||||||||||| ||||||    
47849624 ccacaaaaccgggttgtgaggtgaggattgccccaacttataaacacatgttcatgccatcttttatccgatgtggcactctt 47849542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 15 - 88
Target Start/End: Original strand, 23839109 - 23839182
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    |||||||||| ||||||||||||||||| ||||||| |||||||| ||||| || ||||| | |||||| ||||    
23839109 cacaaaaccggcttgtgaggtgaggatttcccccacttataaacagattgttagaccatctcttatccgttgtg 23839182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 40746324 - 40746243
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    ||||| |||||||| || ||| ||||||||||||||||| ||| |||||||| |||||||||||| | |||| || ||||||    
40746324 acaaccccacaaaatcggcttatgaggtgaggattgccctcacttataaacaaattgtcaggccaactcctaaccaatgtgg 40746243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 41191066 - 41190981
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||| ||||||||||| | ||| |||||||| ||||||||   ||||| |||| ||||||| ||||||||||    
41191066 cacaaaaccggcttgtgatgtgaggattgctctcacttataaacatattgtcagattatcacatatctgatgtgggactcttaaca 41190981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 25620422 - 25620338
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||  ||||||||||| |||||||||| || ||||| |||||||||||| |||  |||||| ||||| | ||||||||||    
25620422 acaaaacctgcttgtgaggtggggattgcccctacttataagcacattgtcaggtcatgtcctatctgatgtaggactcttaaca 25620338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 4506991 - 4506932
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtca 67  Q
    ||||| ||| |||||||||||||||||||||||||||  | || ||||||||||||||||    
4506991 acaaccccataaaaccgacttgtgaggtgaggattgctgcaacgtataaacacattgtca 4506932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 21 - 100
Target Start/End: Complemental strand, 5522925 - 5522846
Alignment:
21 accgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||| |||||||||||| |||||| ||||| || |||||||||||||| ||| | | ||| |||||||| ||||||||||    
5522925 accggcttgtgaggtgaagattgctcccacttaaaaacacattgtcagaccaactcttatacgatgtgggactcttaaca 5522846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 23796209 - 23796288
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgt 87  Q
    ||||| |||||||| | | ||||||||||| |||||||||||| |||||||||||||| || |||||   ||||||||||    
23796209 acaaccccacaaaatcaatttgtgaggtgatgattgcccccacttataaacacattgttagaccatcttttatccgatgt 23796288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 4886377 - 4886323
Alignment:
19 aaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    |||||| ||||||||||||||||||||||||   ||||||| |||||||||||||    
4886377 aaaccggcttgtgaggtgaggattgcccccattaataaacatattgtcaggccat 4886323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 8075918 - 8075852
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    ||||| ||| |||||||||||||||||||| ||||  |||||| |||||||||||| ||| ||||||    
8075918 acaactccataaaaccgacttgtgaggtgaagattatccccacttataaacacattatcatgccatc 8075852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 31257056 - 31257146
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||| ||||||||| |  ||||||||||| |||||||||||| |||||||| |||||||| ||| |  ||| ||||||||  ||||||||    
31257056 acaaccccacaaaactggtttgtgaggtgaagattgcccccacttataaacaaattgtcagaccaacttctaaccgatgtgagactcttaa 31257146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 31892440 - 31892354
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||||||||||| ||||| |||||| |||||| ||||||||| | |||   | ||||||||||  ||||||||||    
31892440 ccacaaaaccggcttgtgaggtgaagattgtccccacttataaatacattgtcatgtcatgttccatccgatgtgagactcttaaca 31892354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 40746064 - 40746150
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| ||  ||||||||||| ||||| |||  | |||||||||||||||  |||||  |||||||||||||| ||||||||||    
40746064 ccacaaaatcggtttgtgaggtgaagattgtcccttcttataaacacattgtctagccatgtcctatccgatgtgggactcttaaca 40746150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 1793805 - 1793727
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||| ||||||||||  |||||||||||||||||||||||||  ||||  |||||||||| ||||| | ||||| |||||    
1793805 acaaccccacaaaacctgcttgtgaggtgaggattgcccccactaataa--acattgtcagaccatctcttatccaatgtg 1793727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 15 - 96
Target Start/End: Complemental strand, 2401412 - 2401331
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||||| |||||||||| |||| ||||| || ||| ||||||||||||||||| ||  | | ||||||||||| |||||||    
2401412 cacaaaatcgacttgtgaagtgaagattgtccacacttataaacacattgtcagaccgcctcttatccgatgtgaaactctt 2401331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 1000608 - 1000560
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataa 56  Q
    ||||| ||||||||||| ||||| ||||||||||||||||||| |||||    
1000608 acaaccccacaaaaccgtcttgtaaggtgaggattgcccccacttataa 1000560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 14540977 - 14541025
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataa 56  Q
    ||||| ||||||||||||||| ||||||| ||||||||||||| |||||    
14540977 acaaccccacaaaaccgacttatgaggtgtggattgcccccacttataa 14541025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 27 - 63
Target Start/End: Original strand, 20305707 - 20305743
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacatt 63  Q
    |||||||||||||||||||||||| ||||||||||||    
20305707 ttgtgaggtgaggattgcccccacttataaacacatt 20305743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 15 - 99
Target Start/End: Original strand, 26028993 - 26029077
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    ||||||| || ||||||||||||||||||| ||||  || ||| | |||||||||||| | |||| ||||||| | |||||||||    
26028993 cacaaaatcggcttgtgaggtgaggattgctcccatttaaaaataaattgtcaggccaactcctaaccgatgtaggactcttaac 26029077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 30727151 - 30727195
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    ||||||||  ||||||||||||||||||||||||| |||||||||    
30727151 acaaaaccagcttgtgaggtgaggattgcccccacttataaacac 30727195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 31257292 - 31257372
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||| ||||||||||| |||||||  | |||||||||||||| |||||| | |||||||| ||| | |||| ||||||||    
31257292 acaaccccacaaaaccggcttgtgaattaaggattgcccccacttataaataaattgtcagaccaactcctaaccgatgtg 31257372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 26 - 89
Target Start/End: Complemental strand, 32292782 - 32292719
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgt-caggccatcacctatccgatgtgg 89  Q
    ||||||||||||||| ||||||||| ||||||||| |||| || |||||||| ||||||||||||    
32292782 cttgtgaggtgaggactgcccccacttataaacac-ttgtgcatgccatcacttatccgatgtgg 32292719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 14 - 50
Target Start/End: Complemental strand, 32474553 - 32474517
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccac 50  Q
    ||||||||||| |||||||||||||||||||||||||    
32474553 ccacaaaaccggcttgtgaggtgaggattgcccccac 32474517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 26 - 88
Target Start/End: Original strand, 14540784 - 14540846
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||||| | |||||||| ||  || |||||||||||||||||| |||| |||||||||||||    
14540784 cttgtgatgagaggattgtccttacttataaacacattgtcaggtcatctcctatccgatgtg 14540846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 21213066 - 21213120
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||| |||||||||| ||||||||||||| |||| | ||||| |||||||||||    
21213066 acaactccacaaaaccaacttgtgaggtgatgattactcccacttataaacacat 21213120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 14 - 88
Target Start/End: Complemental strand, 21821859 - 21821785
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    |||||||| ||  ||||||| ||| |||||||||||| ||| |||| |||||||||||||| | |||| ||||||    
21821859 ccacaaaatcggtttgtgagatgaagattgcccccacttattaacatattgtcaggccatctcatatctgatgtg 21821785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 24432128 - 24432083
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||||||||||||||||||||||| || |||||| |||||||||||    
24432128 acaaaaccgacttgtgaggtgaggactg-ccccacttataaacacat 24432083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 16 - 78
Target Start/End: Original strand, 32279099 - 32279161
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacct 78  Q
    ||||||| | ||||| |||||||||||| || ||| |||||||||||||||||  ||||||||    
32279099 acaaaactggcttgttaggtgaggattgtccacacttataaacacattgtcagatcatcacct 32279161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 26 - 68
Target Start/End: Original strand, 36277034 - 36277076
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    ||||||||||||| |||| |||||| |||||||||||||||||    
36277034 cttgtgaggtgagaattgtccccacttataaacacattgtcag 36277076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 40898740 - 40898794
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||| |||||||| ||  |||| ||||||||||||||||||| |||||||||||    
40898740 acaactccacaaaatcggtttgtaaggtgaggattgcccccacttataaacacat 40898794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 26 - 100
Target Start/End: Complemental strand, 21822084 - 21822006
Alignment:
26 cttgtgaggtgaggattgcccccacata----taaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| ||||||||||||||  |||    |||||||||||| | |||||| | |||||||||||||||| ||||||    
21822084 cttgtgagatgaggattgcccccttataattataaacacattgtgacgccatctcatatccgatgtggaactgttaaca 21822006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 73
Target Start/End: Complemental strand, 32292578 - 32292513
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    ||||| ||||||| ||| |||||||||||||||  |||||||| ||||||||| |  |||||||||    
32292578 acaaccccacaaatccggcttgtgaggtgaggaccgcccccacttataaacacttgttcaggccat 32292513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 40898965 - 40899001
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||||||||||| |||||||||||| |||||||||||    
40898965 cttgtgaggtgatgattgcccccacttataaacacat 40899001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 8 - 60
Target Start/End: Complemental strand, 47849849 - 47849797
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    ||||| ||||||||| | ||||||||||||| |||||||| || |||||||||    
47849849 acaaccccacaaaactggcttgtgaggtgagtattgccccaacttataaacac 47849797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 66; Significance: 6e-29; HSPs: 90)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 25145517 - 25145602
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||||||||||||||||||  |||||||||||||||| |||||||||||||||||||  ||||||||||    
25145517 cacaaaaccgacttgtgaggtgaggattgcccccactaataaacacattgtcagaccatcacctatccgatgtgagactcttaaca 25145602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 25713452 - 25713360
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| | |||||||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||||||    
25713452 acaactccacaaaactggcttgtgaggtgacgattgcccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaaca 25713360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 35772323 - 35772231
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||| |||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||    
35772323 acaaccccacaaaaccggcttctgaggtaaggattgcccccacttataaacacattgtcaggccatctcctatccgatgtgggactcttaaca 35772231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 15 - 97
Target Start/End: Original strand, 2859424 - 2859506
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctta 97  Q
    |||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||    
2859424 cacagaaccggcttgtgaggtaaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactctta 2859506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 8 - 102
Target Start/End: Original strand, 4113031 - 4113125
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacaga 102  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||  || ||||||||||| ||| ||||||||    
4113031 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcccatccgatgtgggacttttaacaga 4113125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 52650796 - 52650888
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||  ||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||| |||| |||||    
52650796 acaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtccggccatctcctatccgatgtgggactcctaaca 52650888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 40079211 - 40079132
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgt 87  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||    
40079211 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggtcatctcctatccgatgt 40079132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 15 - 101
Target Start/End: Original strand, 2859659 - 2859745
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    |||||||||| ||||||||||||||||| |||||||  |||||||||||||||| |||||||||||||||||||  |||||||||||    
2859659 cacaaaaccggcttgtgaggtgaggattacccccactaataaacacattgtcagaccatcacctatccgatgtgagactcttaacag 2859745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 16163220 - 16163134
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||  ||||||||||| |||||||||||| |||||||||||||||| | ||||||||||||||||||| ||||||||||    
16163220 ccacaaaaccggattgtgaggtgaagattgcccccacttataaacacattgtcaagtcatcacctatccgatgtgggactcttaaca 16163134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 38668413 - 38668327
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||| |||||| |||||||||||| ||||||||||||||||  ||||||| |||||||||||| ||||||||||    
38668413 ccacaaaaccgacttgtaaggtgatgattgcccccacttataaacacattgtcaaaccatcacatatccgatgtgggactcttaaca 38668327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 856033 - 855948
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||  |||||||||||||||||| |||||| ||||||||||||||||||||||  |||||||| ||||||||||||||||    
856033 cacaaaaccagcttgtgaggtgaggattgtccccacgtataaacacattgtcaggccatgtcctatccggtgtggaactcttaaca 855948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 15986358 - 15986450
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||| |||  ||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||| | ||||||||||    
15986358 acaaccccacaataccagcttgtgaggtgaggattgcccccacttataaacacattgtcaggctatctcctatccgatgtaggactcttaaca 15986450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 17452853 - 17452945
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||| |||||||||||| |||||| |||||||||||||||  | |||||||||||| ||||||||||    
17452853 acaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaatacattgtcaggccatgtcttatccgatgtgggactcttaaca 17452945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 25145745 - 25145837
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||| ||| |||||||||||||||||||||||||  ||||| ||||||||||| ||||||||||||||||||  ||||||||||    
25145745 acaaccccacaaatccggcttgtgaggtgaggattgcccccactaataaatacattgtcaggtcatcacctatccgatgtgagactcttaaca 25145837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 32 - 100
Target Start/End: Original strand, 51459879 - 51459947
Alignment:
32 aggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||    
51459879 aggtgaggattgcccccacttataaacacattgttaggccatcacctatccgatgtgggactcttaaca 51459947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 25 - 100
Target Start/End: Original strand, 8870731 - 8870806
Alignment:
25 acttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||||||||||| ||||||||||||||||  |||||||| ||||||||||| ||||||||||    
8870731 acttgtgaggtgaggattgcccccacttataaacacattgtcacaccatcaccgatccgatgtgggactcttaaca 8870806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 8 - 103
Target Start/End: Complemental strand, 38080663 - 38080569
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacagaa 103  Q
    ||||| ||||||||| | |||||||||||||||||||||| |  ||||||||||||||||||||||| || ||||||||||| |||||||||||||    
38080663 acaaccccacaaaactggcttgtgaggtgaggattgccccaat-tataaacacattgtcaggccatctcccatccgatgtgggactcttaacagaa 38080569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 27413631 - 27413549
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| ||||||||||||||||||| |||| |||||||| |||||||||||||||||||| |||||||| ||| ||||||    
27413631 aaaaccgatttgtgaggtgaggattgcctccacttataaacatattgtcaggccatcacctatgcgatgtgggacttttaaca 27413549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 3169825 - 3169733
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||| |||||||||||| |||||||| |||||||| ||| | |||| ||||||||| ||||||||||    
3169825 acaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca 3169733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 51589051 - 51588959
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||| ||| |||||||| |||||||| ||| | |||| ||||||||| ||||||||||    
51589051 acaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca 51588959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 51589285 - 51589193
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||| ||| |||||||| |||||||| ||| | |||| ||||||||| ||||||||||    
51589285 acaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca 51589193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 52961641 - 52961549
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||| ||||||| ||| ||||||||||||||||| ||| ||||||||||||||||| ||||| |||||||||||||| || |||||||    
52961641 acaaccccataaaaccggcttttgaggtgaggattgccctcacttataaacacattgtcagaccatctcctatccgatgtgggacacttaaca 52961549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 30 - 101
Target Start/End: Original strand, 20208573 - 20208644
Alignment:
30 tgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||||||||||||||||||| ||||||||||||||||| ||||  |||||||||||||| |||||||||||    
20208573 tgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatccgatgtgggactcttaacag 20208644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 41035858 - 41035944
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||||||||||||||||||||||||| |||||||| |||| ||||||||  ||||||||| |||  ||||||||||    
41035858 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattggcaggccatgtcctatccgacgtgagactcttaaca 41035944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 8 - 73
Target Start/End: Original strand, 17452704 - 17452769
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||    
17452704 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggccat 17452769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 26176967 - 26176874
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| |||||||||||  || ||||||||||||||||| ||| ||||| ||||||||||||||||  ||| |||||||||| |||||||||||    
26176967 acaaccccacaaaaccggtttttgaggtgaggattgccctcacttataagcacattgtcaggccatgtcctgtccgatgtgggactcttaacag 26176874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 38733203 - 38733119
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||| |||| |||| ||| || ||||||||||||||||| ||||||| ||| |||||||||||||||||||    
38733203 cacaaaaccgacttgtgagatgagaattgtccc-acttataaacacattgtcagaccatcacatattcgatgtggaactcttaaca 38733119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 38733434 - 38733349
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| | | ||||||||||||||||| ||| |||||||| |||||||| ||||||| |||||||||||| ||||||||||    
38733434 cacaaaaccggcctatgaggtgaggattgccctcacttataaacatattgtcagaccatcacatatccgatgtgggactcttaaca 38733349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 30369894 - 30369802
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||   |||||||||||||||||||||| || |||||||| |||||| | ||||| | |||||||||||||||||||||||    
30369894 acaaccccacaaaactatcttgtgaggtgaggattgcccctacttataaacatattgtcggaccatctcatatccgatgtggaactcttaaca 30369802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 31181538 - 31181626
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||| ||||||  ||||||||||||||||||||||||| |||||||||||  |||||||||| | ||||| |||||||||||||    
31181538 acaaccccataaaaccagcttgtgaggtgaggattgcccccacttataaacacatgttcaggccatctcttatccaatgtggaactctt 31181626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 39348377 - 39348457
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||| |||||||||||  |||||||||||||||||||||||| ||||||||| |||||| |||||| |||||| ||||||    
39348377 acaaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaacacgttgtcaagccatctcctatctgatgtg 39348457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 8 - 99
Target Start/End: Original strand, 25137328 - 25137419
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    ||||| ||||||||||| ||| |||||||||||||||||  || |||||||| |||||||||||| | |||| ||||||||| |||||||||    
25137328 acaaccccacaaaaccggcttatgaggtgaggattgcccatacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaac 25137419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 51459736 - 51459822
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||  ||||| || || ||||||||||||| |||||||||||||| |||| |||||||||||||| ||| ||||||||||    
51459736 ccacaaaaccagcttgtaagatgcggattgcccccacttataaacacattgttaggctatcacctatccgatatgggactcttaaca 51459822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 11924973 - 11924888
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||  |||| ||||||| | | ||||||| |||||||| |||||||| ||||||||||||||||||| |||||||||||    
11924973 cacaaaaccggtttgtaaggtgagaaatacccccacttataaacatattgtcagaccatcacctatccgatgtgtaactcttaaca 11924888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 26173481 - 26173574
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| |||   ||||||| ||||||||||| ||||||||||||||||| ||||| | |||| ||||||| |||||||||||    
26173481 acaaccccacaaaaccggcttacaaggtgagaattgcccccacttataaacacattgtcagaccatctcatatctgatgtgggactcttaacag 26173574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 28408066 - 28408159
Alignment:
7 aacaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| ||||||||||| |||||||||| ||||||| |||||| |||||||| |||||||| ||| |  ||| ||||||||| ||||||||||    
28408066 aacaaccccacaaaaccggcttgtgaggtaaggattgtccccacttataaacaaattgtcagaccaacttctaaccgatgtgggactcttaaca 28408159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 32 - 100
Target Start/End: Original strand, 51460130 - 51460199
Alignment:
32 aggtgaggattgcccc-cacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||| ||| |||||||||||||| ||||||||||||||||||||||| ||||||||||    
51460130 aggtgaggattaccccacacttataaacacattgttaggccatcacctatccgatgtgggactcttaaca 51460199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 12244987 - 12245079
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||| ||| ||| | ||||  |||||| | ||||||||||    
12244987 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgccagaccaactcctaatcgatgtaggactcttaaca 12245079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 26177202 - 26177110
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| |  || ||||||||||||||||||||| ||||||||| |||||||| |||  ||| |||||||||| ||||||||||    
26177202 acaaccccacaaaactggtttttgaggtgaggattgcccccacttataaacacgttgtcaggtcatgtcctgtccgatgtgggactcttaaca 26177110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 26865383 - 26865475
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||| ||||||||||||| |||||| ||||||||||| |||  | | |||||||||| || |||||||    
26865383 acaaccccacaaaaccggcttgtgaggtggggattgcccccacttataaatacattgtcaggtcatgtcttgtccgatgtgggacacttaaca 26865475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 39348144 - 39348232
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||| ||||| || || || ||||||||||| |||| ||||||||||||||||||| ||| |||||||||||||| ||||||    
39348144 acaaccccacagaaccggctggtaagttgaggattgcctccacttataaacacattgtcaggctatctcctatccgatgtgggactctt 39348232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 42586464 - 42586555
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||  | |||||||||||||||||||||| || |||| |||||||||||||||||| | |||||||||||  ||||||||||    
42586464 acaaccccacaaaattggcttgtgaggtgaggattgcccc-acttatatacacattgtcaggccatctcttatccgatgtgagactcttaaca 42586555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 4112805 - 4112888
Alignment:
18 aaaaccgacttgtgaggtgaggattgccccc-acatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||  |||||||||||||||| ||||| || ||||||||||||||||||||||  || ||||||||||| ||||||||||    
4112805 aaaaccggtttgtgaggtgaggatttccccccacttataaacacattgtcaggccatgtcccatccgatgtgggactcttaaca 4112888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 8 - 103
Target Start/End: Complemental strand, 16162992 - 16162897
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacagaa 103  Q
    ||||| |||||||| ||  || |||||||||| ||| |||||| || |||||||||||||||||||||| |||||||||||  |||||||| ||||    
16162992 acaaccccacaaaatcggtttatgaggtgaggtttgtccccacttaaaaacacattgtcaggccatcacatatccgatgtgagactcttaatagaa 16162897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 4098433 - 4098519
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| |||||| ||||||||||||||||||| |||||||||||| |||  |||||   |||||||||||  ||||||||||    
4098433 ccacaaaaccaacttgtaaggtgaggattgcccccacttataaacacattatcaaaccatctattatccgatgtgcgactcttaaca 4098519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 4112583 - 4112657
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||| ||||||||| || |||||||||||||||| |||||  ||| |||||||||| ||||||||||    
4112583 cttgtgaggtgatgattgcccctacttataaacacattgtcatgccatgtcctgtccgatgtgggactcttaaca 4112657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 14 - 96
Target Start/End: Complemental strand, 17468397 - 17468315
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||| |||| ||||| |||||||||||||||| |||||||| |||||||| ||||| | |||||||||||| ||||||    
17468397 ccacataacggactggtgagatgaggattgcccccacttataaacatattgtcagaccatctcttatccgatgtgggactctt 17468315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 14 - 68
Target Start/End: Original strand, 26173255 - 26173309
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    ||||||||||| |||||||||||| |||||||||||| |||||||||||||||||    
26173255 ccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcag 26173309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 35892344 - 35892258
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||  |||||||||||| ||||||||||| |||||| |||||||||| |||||   |||| ||||||| ||||||||||    
35892344 ccacaaaaccgggttgtgaggtgagtattgcccccacttataaatacattgtcagaccatcttatatctgatgtgggactcttaaca 35892258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 33 - 99
Target Start/End: Complemental strand, 39808500 - 39808434
Alignment:
33 ggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    ||||||||||| |||||| ||||||||||||||||| ||||||| ||||| |||||| |||||||||    
39808500 ggtgaggattgtccccacttataaacacattgtcagaccatcacatatccaatgtgggactcttaac 39808434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 3170060 - 3169967
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatat-aaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||| |||||||||| ||| ||| ||||| |||||||| ||| | |||| ||||||||| ||||||||||    
3170060 acaaccccacaaaaccggcttgtgaggtaaggattgccctcacttataaaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca 3169967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 17402630 - 17402549
Alignment:
19 aaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||| |||||||| |||||||| ||| | |||||| |||||||| |||||||||||||||||||| |||| |||||    
17402630 aaacccacttttgaggtgaagattgcccgcacttttaaacaaattgtcagaccatcacctatccgatgtgggactcataaca 17402549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 7307772 - 7307688
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||||| |||||| |||| |||||||||||||| ||| ||||   | |||||||| | ||||||||||    
7307772 acaaaaccgacttgtgaggtgagaattgcctccacttataaacacattgttaggtcatcttatgtccgatgttggactcttaaca 7307688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 33 - 101
Target Start/End: Complemental strand, 13386282 - 13386214
Alignment:
33 ggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    |||||||||| |||| || |||| |||||||| ||||||||  ||||||||||||||||||||||||||    
13386282 ggtgaggattaccccaacttatatacacattgccaggccatgtcctatccgatgtggaactcttaacag 13386214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 52 - 100
Target Start/End: Complemental strand, 33156984 - 33156936
Alignment:
52 tataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||| ||||| |||||||||||||||||||||||||    
33156984 tataaacacattgtcagaccatctcctatccgatgtggaactcttaaca 33156936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 16 - 99
Target Start/End: Complemental strand, 369686 - 369603
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    ||||||||  ||||| ||||||||||||||||||| |||||||||||| |||| | ||| |||  ||||||||| |||||||||    
369686 acaaaaccatcttgtaaggtgaggattgcccccacttataaacacattttcagactatctcctgcccgatgtgggactcttaac 369603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 14 - 96
Target Start/End: Original strand, 21626370 - 21626452
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    |||||||||||  || ||| |||||||| |||||||| |||||||| |||||||||||||| | |||| ||||||| ||||||    
21626370 ccacaaaaccggattttgaagtgaggatggcccccacttataaacatattgtcaggccatctcttatctgatgtgggactctt 21626452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 52907443 - 52907389
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||| ||||||||||  ||||||||||||||||||||||||| |||||||||||    
52907443 acaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacat 52907389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 43409865 - 43409773
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| || |||||||| ||||||||||||| |||||||| || |||||| |||||||||| ||||   ||||||||||||  |||||||||||    
43409865 acaaccccccaaaaccggcttgtgaggtgagaattgcccc-acttataaatacattgtcagaccatgttctatccgatgtgagactcttaacag 43409773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 20 - 96
Target Start/End: Original strand, 7826068 - 7826144
Alignment:
20 aaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| |||||||||| ||||||| |||||| ||||||||||||||||| |||||   ||| |||||||| ||||||    
7826068 aaccggcttgtgaggtaaggattgtccccacttataaacacattgtcagaccatcttttattcgatgtgggactctt 7826144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 38668184 - 38668092
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||  | |||||||| ||| |||||||||||| ||||||||||||||||   |||||| ||||  | |||||||||||||||    
38668184 acaaccccacaaaattggcttgtgagatgatgattgcccccacttataaacacattgtcatttcatcacttatctaacgtggaactcttaaca 38668092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 32 - 100
Target Start/End: Original strand, 51460256 - 51460324
Alignment:
32 aggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| ||||||||| || |||||||||||||| ||| ||||||||||| ||||| | ||||||||||    
51460256 aggtgatgattgcccctacttataaacacattgttaggtcatcacctatctgatgttggactcttaaca 51460324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 51589865 - 51589805
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    ||||| |||||||| || ||||||||||||||||||||| ||| |||||||| ||||||||    
51589865 acaaccccacaaaatcggcttgtgaggtgaggattgccctcacttataaacaaattgtcag 51589805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 73
Target Start/End: Complemental strand, 17402751 - 17402708
Alignment:
30 tgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    ||||||||||||||||||||| |||||||| |||||||||||||    
17402751 tgaggtgaggattgcccccacttataaacaaattgtcaggccat 17402708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 16 - 62
Target Start/End: Original strand, 12376470 - 12376516
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||||||||||||||| |||| |||||||||||| |||||||||||    
12376470 acaaaaccgacttgtgaagtgaagattgcccccacttataaacacat 12376516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 16 - 62
Target Start/End: Original strand, 31004470 - 31004516
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||||||  ||||||||||||||||||||||||| |||||||||||    
31004470 acaaaaccagcttgtgaggtgaggattgcccccacttataaacacat 31004516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 32223822 - 32223756
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    ||||| ||||| ||| | |||||||| ||||||| ||||||||||||||||||||  ||||||||||    
32223822 acaaccccacacaactggcttgtgagatgaggatcgcccccacatataaacacatgttcaggccatc 32223756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 32952120 - 32952038
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||  ||||||| | |||| ||||||||||||||||  ||| | ||||||| |||||| | ||||||||    
32952120 aaaaccgacttgtgagggaaggattggctccacttataaacacattgtcaaaccaactcctatccaatgtgggattcttaaca 32952038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 42351885 - 42351939
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||||||||||||| | |||||||||||||||| ||| |||| |||||||||||    
42351885 acaacaccacaaaactggcttgtgaggtgaggatggcctccacttataaacacat 42351939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 4098195 - 4098280
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||  |||||| | ||||||||||||||| ||||||||||| ||||| | ||| | ||| |||||||  ||||||||||    
4098195 cacaaaaccggtttgtgaagagaggattgcccccacttataaacacatcgtcagacgatctcatattcgatgtgagactcttaaca 4098280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 7465681 - 7465722
Alignment:
19 aaaccgacttgtgaggtgaggattgcccccacatataaacac 60  Q
    |||||| ||||||||||||||||||||||||| |||||||||    
7465681 aaaccggcttgtgaggtgaggattgcccccacttataaacac 7465722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 9499304 - 9499224
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    ||||| |||||||||||  ||||||||||| ||||||||| || |||||||| |||||||| | ||| ||||||||| ||||    
9499304 acaaccccacaaaaccgg-ttgtgaggtgaagattgcccctacttataaacatattgtcagactatctcctatccgacgtgg 9499224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 14 - 87
Target Start/End: Original strand, 40524682 - 40524755
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgt 87  Q
    ||||||| |||| || |||||||| |||||||||||| |||||||||| |||||| ||||| | ||| ||||||    
40524682 ccacaaagccgatttatgaggtgaagattgcccccacttataaacacactgtcagaccatctcatattcgatgt 40524755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 68
Target Start/End: Original strand, 8870935 - 8870995
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    ||||| |||||||| || ||| ||||||||| |||||||| || |||||||||||||||||    
8870935 acaaccccacaaaaacggcttatgaggtgagaattgccccaacttataaacacattgtcag 8870995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 12325331 - 12325375
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||||||||||||| |||| |||||||||||| |||||||||||    
12325331 aaaaccgacttgtgaagtgaagattgcccccacttataaacacat 12325375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 31 - 99
Target Start/End: Complemental strand, 17412372 - 17412304
Alignment:
31 gaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    |||||| |||||| |||||| |||||||||||| |||| | ||| |||||||||||||  |||||||||    
17412372 gaggtgcggattgtccccacttataaacacattatcagacaatctcctatccgatgtgagactcttaac 17412304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 68
Target Start/End: Original strand, 26346993 - 26347053
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    ||||| ||||||||| | |||||||||||||||||| | |||| ||||||||||| |||||    
26346993 acaaccccacaaaacgggcttgtgaggtgaggattgtctccacttataaacacatcgtcag 26347053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 31432255 - 31432295
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccccc 48  Q
    ||||| ||||||||||| |||||||||||||||||||||||    
31432255 acaaccccacaaaaccggcttgtgaggtgaggattgccccc 31432295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 52127779 - 52127688
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| |  |||||||||||||||||| |||||| |||||||| ||| | ||| || | |||| ||||||||| ||||||||||    
52127779 acaaccccacaaaagcagcttgtgaggtgaggattg-ccccacttataaacaaattcttaggtcaactcctaaccgatgtgggactcttaaca 52127688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 30 - 89
Target Start/End: Original strand, 3477223 - 3477282
Alignment:
30 tgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    |||||| ||||| |||||||| |||||||||||| ||||| |||| ||||| ||||||||    
3477223 tgaggtaaggatcgcccccacttataaacacattatcaggacatctcctattcgatgtgg 3477282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 62
Target Start/End: Original strand, 40316082 - 40316129
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||||||||| ||| |||||||||||||| |||||| |||||||||||    
40316082 cacaaaaccggcttatgaggtgaggattgaccccacttataaacacat 40316129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 51590091 - 51590007
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||||||||||||||||||  | ||| |||||||| |||||||| | | | |||| | ||||||| ||||||||||    
51590091 ccacaaaaccggcttgtgaggtgaggattg--ctcacttataaacaaattgtcagacaaactcctaactgatgtgggactcttaaca 51590007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 22377584 - 22377542
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaa 57  Q
    ||||||||||||||| ||||||| |||||||||||| ||||||    
22377584 cacaaaaccgacttgcgaggtgatgattgcccccacttataaa 22377542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 17412619 - 17412534
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||| || ||||||| ||||  || |||  ||| |||||||||||||||||| |||| |||||| ||||||| ||| ||||||    
17412619 cacaaaatcggcttgtgaagtgaatatcgccatcacttataaacacattgtcaggtcatctcctatctgatgtgggacttttaaca 17412534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 27413399 - 27413314
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||| || |||||||||||||||||| | |||  |||| |||||||| |||| ||||  |||||| |||||| ||| ||||||    
27413399 cacaaaatcggcttgtgaggtgaggattgtctccagttatacacacattgccaggacatcgtctatccaatgtgggacttttaaca 27413314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 16 - 81
Target Start/End: Original strand, 34264743 - 34264808
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatc 81  Q
    ||||||| |||||||||| || |||||  |||||| ||||||||||||||||| || || ||||||    
34264743 acaaaactgacttgtgagatgtggattatccccacttataaacacattgtcagaccgtctcctatc 34264808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 23 - 68
Target Start/End: Complemental strand, 49142552 - 49142507
Alignment:
23 cgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    |||||||||||||| ||||||||| ||| | |||||||||||||||    
49142552 cgacttgtgaggtggggattgccctcacttctaaacacattgtcag 49142507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 15 - 63
Target Start/End: Complemental strand, 5109536 - 5109488
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacatt 63  Q
    ||||||||| |||||||||||||||||| | || || ||||||||||||    
5109536 cacaaaacccacttgtgaggtgaggattacaccgacttataaacacatt 5109488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 52 - 100
Target Start/End: Complemental strand, 33156453 - 33156405
Alignment:
52 tataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||| |||| || || |||||||| ||||||||||    
33156453 tataaacacattgtcaggtcatctccaatacgatgtgggactcttaaca 33156405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 49142994 - 49142958
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||||||| |||||||||||||||| |||||||||||    
49142994 cttgtgagctgaggattgcccccacttataaacacat 49142958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 65; Significance: 2e-28; HSPs: 75)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 4868602 - 4868694
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||  ||| |||||||||| ||||||||||    
4868602 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca 4868694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 13740975 - 13740885
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||| ||||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||| ||| |||||||||||||||||||||    
13740975 acaaccccacaaaaccgacttgtgaagtgaggattgctcccacttataaacaaattgtcaggccaacacatatccgatgtggaactcttaa 13740885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 13746475 - 13746385
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||| ||||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||| ||| |||||||||||||||||||||    
13746475 acaaccccacaaaaccgacttgtgaagtgaggattgctcccacttataaacaaattgtcaggccaacacatatccgatgtggaactcttaa 13746385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 3680298 - 3680213
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| ||||||||||||| |||||||||||| ||||||||||||||||| ||||||| |||||||||||| ||||||||||    
3680298 cacaaaaccaacttgtgaggtgatgattgcccccacttataaacacattgtcagaccatcacatatccgatgtgggactcttaaca 3680213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 6542968 - 6543061
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||| |||||||| |||||||||||| ||||||||||||||||| ||||| | ||||||||||||||||||||||||    
6542968 acaaccccacaaaaccggcttctgaggtgatgattgcccccacttataaacacattgtcagaccatctcttatccgatgtggaactcttaacag 6543061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 9705079 - 9704986
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| |||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||  |||||||||||||  |||||||||||    
9705079 acaaccccacaaaaccgacttgtgaggtgatgattgcccccacttataaacacattgtcaggctatgtcctatccgatgtgagactcttaacag 9704986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 13353260 - 13353167
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||  ||| |||||||||| |||||||||||    
13353260 acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacag 13353167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 4868838 - 4868930
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||  ||| |||||||||| ||||||||||    
4868838 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgccaggccatgtcctgtccgatgtgggactcttaaca 4868930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 9705313 - 9705221
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||| | |||||  |||||||||||||| ||||||||||    
9705313 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgttaagccatgtcctatccgatgtgggactcttaaca 9705221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 33494598 - 33494506
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| ||| ||| |||||| |||||||||||||| ||||||||||    
33494598 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattttcaagccatctcctatccgatgtgggactcttaaca 33494506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 33796385 - 33796293
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||  ||| |||||||||| ||||||||||    
33796385 acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca 33796293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 14 - 101
Target Start/End: Complemental strand, 27653270 - 27653183
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||||||||||||||||||||||||||| ||||||| |||||||| |||||||||||| | |||| ||||||||| |||||||||||    
27653270 ccacaaaaccgacttgtgaggtgaggatttcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacag 27653183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 17147691 - 17147777
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||| |||  |||||||||||||| ||||||||||    
17147691 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggtcatgtcctatccgatgtgggactcttaaca 17147777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 19713005 - 19712919
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||||||||||||| ||||||||||| |||||||| |||||||||||| | |||| ||||||||||||||||||||    
19713005 ccacaaaaccggcttgtgaggtgagaattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaaca 19712919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 30256871 - 30256782
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||| ||||||||||| |||||||||||||||||||||| || |||||||| ||||||||| ||||||||||||||||||| ||||||||    
30256871 acaaccccacaaaaccggcttgtgaggtgaggattgcccc-acttataaacatattgtcaggtcatcacctatccgatgtgggactcttaa 30256782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 27772773 - 27772680
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||| | |||||||||    
27772773 acaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggaatcttaacag 27772680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 2736435 - 2736519
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||| ||||| ||||||||||| |||||||||||| ||||| |||| | |||||||||||||||||||||||    
2736435 acaaaaccgacttgtgatgtgagaattgcccccacttataaacacattatcaggtcatctcatatccgatgtggaactcttaaca 2736519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 2737203 - 2737287
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||| ||||| ||||||||||| |||||||||||| ||||| |||| | |||||||||||||||||||||||    
2737203 acaaaaccgacttgtgatgtgagaattgcccccacttataaacacattatcaggtcatctcatatccgatgtggaactcttaaca 2737287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 2753317 - 2753225
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||  ||||| || |||||||||| ||||||||||    
2753317 acaaccccacaaaaccgccttgtgaggtgaggattacccccacttataaacacattgtcagatcatcatctttccgatgtgggactcttaaca 2753225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 24554176 - 24554084
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||| |||||||||||| |||||| | |||||||| ||||| |||||||||||||| ||||||||||    
24554176 acaactccacaaaaccggcttgtgaggtgaagattgcccccacttataaatatattgtcagaccatctcctatccgatgtgggactcttaaca 24554084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 27656517 - 27656425
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||| ||||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
27656517 acaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 27656425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 25065119 - 25065209
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||| ||||||||||| |||||||||||||||||||||| || |||||||| |||||||| ||||  |||||||||||||| ||||||||    
25065119 acaaccccacaaaaccggcttgtgaggtgaggattgcccctacttataaacatattgtcagaccatgtcctatccgatgtgggactcttaa 25065209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 27772999 - 27772913
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||  ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
27772999 ccacaaaaccagcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 27772913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 31961218 - 31961145
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| |||||||||||||| ||||||||||||||||||||||||| |||| ||||||| ||||||||||    
31961218 ttgtgaggtaaggattgcccccacttataaacacattgtcaggccatcacatatctgatgtgggactcttaaca 31961145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 6400645 - 6400737
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||||||  | | |||||||||  ||||||||||    
6400645 acaaccccacaaaaccgacttgtgatgtgaggattgcctccacttataaacacattgtcaggccatgtcatgtccgatgtgagactcttaaca 6400737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 8026448 - 8026356
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | | || |||| |||| ||||||||||    
8026448 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcataaccgacgtgggactcttaaca 8026356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 8566984 - 8567075
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||||  ||||||||||||||||| ||| || ||||||||||||||||| ||||||||||||||| |||| ||||||||||    
8566984 acaaccccacaaaaccggtttgtgaggtgaggattgtccc-acttataaacacattgtcagaccatcacctatccgaggtgggactcttaaca 8567075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 21690781 - 21690689
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| || ||||||||||||||||||||||||| |||||||| ||||||||||||   |||| ||||||||| ||||||||||    
21690781 acaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaaatcctaaccgatgtgggactcttaaca 21690689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 6400877 - 6400963
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||||||||||||||||||| |||| |||||||| |||||||||||||  | | |||||||||| ||||||||||    
6400877 ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacatattgtcaggccatgtcatgtccgatgtgggactcttaaca 6400963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 8 - 97
Target Start/End: Original strand, 12199830 - 12199919
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctta 97  Q
    |||||| |||||||| |||||||||||||| |||||||||||| |||||||| |||||||| ||||  | |||||||||||| |||||||    
12199830 acaacatcacaaaacggacttgtgaggtgatgattgcccccacttataaacatattgtcagaccatatcttatccgatgtgggactctta 12199919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 12330323 - 12330407
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| |||||||| ||||||||||||| || ||||||||||||||||| ||||  |||||||||||||| ||||||||||    
12330323 cacaaaaccggcttgtgagatgaggattgcccc-acttataaacacattgtcagaccatgtcctatccgatgtgggactcttaaca 12330407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 15600995 - 15600903
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| ||||||||| ||||||||||||||||| |||||||| ||| |||| ||| | |||| ||||||||| ||||||||||    
15600995 acaaccccacaaaactgacttgtgaagtgaggattgcccccacttataaacaaattatcagaccaactcctaaccgatgtgggactcttaaca 15600903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 28867982 - 28868074
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||| | ||||||||| || | | || ||||||||| ||||||||||    
28867982 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaataaattgtcaggtcaactcgtaaccgatgtgggactcttaaca 28868074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 21 - 100
Target Start/End: Original strand, 6237740 - 6237819
Alignment:
21 accgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||| ||||||||||||||||||||| ||| |||||| ||||||||||||| |||| ||||| |||||| ||||||||||    
6237740 accggcttgtgaggtgaggattgccctcacttataaatacattgtcaggccttcacttatccaatgtgggactcttaaca 6237819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 7 - 100
Target Start/End: Complemental strand, 7915911 - 7915817
Alignment:
7 aacaacaccacaaaaccgacttgtgaggtgaggattgc-ccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| |||||||| || ||||||||||||||||||| |||||| ||||||||||||||||||||| |  |||||| |||| | ||||||||||    
7915911 aacaaccccacaaaatcggcttgtgaggtgaggattgccccccacttataaacacattgtcaggccaacttctatccaatgttggactcttaaca 7915817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 15 - 85
Target Start/End: Original strand, 12330211 - 12330281
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgat 85  Q
    |||||||||| |||||||||||||| |||||||||| ||||||||||||||||| ||||  ||||||||||    
12330211 cacaaaaccggcttgtgaggtgagggttgcccccacttataaacacattgtcagaccatgtcctatccgat 12330281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 16722832 - 16722918
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactc 94  Q
    ||||| |||||||| || ||||||||||||| ||||| ||||| |||||||| ||| |||||||||||| |||||||||||| ||||    
16722832 acaaccccacaaaatcggcttgtgaggtgagaattgctcccacttataaacagattatcaggccatcacatatccgatgtgggactc 16722918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 3680071 - 3679979
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| |||||||||||  ||||||||||||||  ||||||||||||||||| | ||||| ||||||| |||  ||||||||||    
3680071 acaaccccacaaaatcgacttgtgagaggaggattgcccccagttataaacacattgtcagactatcacttatccgacgtgagactcttaaca 3679979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 5572409 - 5572489
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||| |||||||||||||||||||||||||||| ||||| || |||||||| |||||||||| | | |||| ||||||||    
5572409 acaaccccacaaaaccgacttgtgaggtgaggatggccccaacttataaacaaattgtcaggcaaactcctaaccgatgtg 5572489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 16 - 88
Target Start/End: Original strand, 15102964 - 15103036
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||||||| | ||||| ||||| ||||||||| | |||||||||||||||||| ||||||||||||||||||    
15102964 acaaaaccggcctgtgaagtgagaattgcccccgcttataaacacattgtcaggtcatcacctatccgatgtg 15103036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 21215044 - 21214952
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||||||| |||||||| ||||||||  || |||||||||||||| || ||||||||||| ||| |||  ||||||||||    
21215044 acaaccccacaaaaccgacttttgaggtgatgattgcccaaacttataaacacattgtgagaccatcacctattcgacgtgtgactcttaaca 21214952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 32 - 103
Target Start/End: Complemental strand, 6369499 - 6369428
Alignment:
32 aggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacagaa 103  Q
    ||||||||||||||||||| |||||||||||||| ||  |||||||| ||| |||||| |||||||||||||    
6369499 aggtgaggattgcccccacttataaacacattgttagatcatcacctgtccaatgtgggactcttaacagaa 6369428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 30 - 100
Target Start/End: Original strand, 2736214 - 2736284
Alignment:
30 tgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||| |||||| |||||||||||||||||| |||| |||| ||||||||| ||||| ||||    
2736214 tgaggtgaggattgtccccacttataaacacattgtcaggtcatctcctacccgatgtgggactctcaaca 2736284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 100
Target Start/End: Complemental strand, 4906847 - 4906773
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| |||||||||||| ||| ||||||||||||||| | | ||| | |||||||||||||||||||||||    
4906847 cttgtgagatgaggattgccctcacttataaacacattgtccgacaatctcttatccgatgtggaactcttaaca 4906773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 15081939 - 15082025
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||||||| | |||||||||||||| | |||||| |||||||| ||||| |||| ||| ||||| ||||||||||    
15081939 ccacaaaaccggcttgtgagttaaggattgcccccacttgtaaacatattgtcagtccatctcctaaccgttgtgggactcttaaca 15082025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 19639144 - 19639230
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||| ||||||  ||||||||||||||||| |||||| ||||||||||||||||||||||  | ||||| |||||| | ||||||||    
19639144 ccactaaaccggtttgtgaggtgaggattgtccccacttataaacacattgtcaggccatatcttatcctatgtgggattcttaaca 19639230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 6054443 - 6054370
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||||||||| |||||| || ||||||| ||||| | |||||||||| | ||||||||||    
6054443 ttgtgaggtgaggattgcccccacttataaataccttgtcagaccatctcttatccgatgttggactcttaaca 6054370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 15 - 88
Target Start/End: Complemental strand, 11085633 - 11085560
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    |||||||||| ||||||| ||||| ||||||||||| |||||||| |||||| ||||||| |||| ||||||||    
11085633 cacaaaaccggcttgtgaagtgagaattgcccccacttataaacatattgtcgggccatctcctacccgatgtg 11085560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 9 - 86
Target Start/End: Original strand, 33631831 - 33631907
Alignment:
9 caacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatg 86  Q
    |||| |||||||||||  || ||||||||||||||  ||||| |||||||||||||||||| ||||||||||||||||    
33631831 caaccccacaaaaccgg-ttatgaggtgaggattgttcccacttataaacacattgtcaggtcatcacctatccgatg 33631907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 6066034 - 6065942
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccg--atgtggaactcttaaca 100  Q
    ||||| |||||||||| |||||| ||||||||||||||||  | ||||||||||||||||| ||||||| |||| |  |||||| ||||||||||    
6066034 acaaccccacaaaaccaacttgtcaggtgaggattgcccc--cttataaacacattgtcagaccatcacatatctgatatgtgggactcttaaca 6065942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 16570218 - 16570130
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||||||||||||||| | ||||||||| ||||| | |||||||||||||||||| |||| | ||||  |||||| ||||||    
16570218 acaaccccacaaaaccgacttgttacgtgaggattacccccgcttataaacacattgtcaggacatctcttatcttatgtggtactctt 16570130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 59
Target Start/End: Complemental strand, 19712773 - 19712722
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaaca 59  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||    
19712773 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 19712722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 12329987 - 12330061
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||||||| |||||||||||||| |   |||  | |||||||||||| ||||||||||    
12329987 cttgtgaggtgaggattgcccccacttataaacacattgttatatcatatcttatccgatgtgggactcttaaca 12330061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 5572651 - 5572732
Alignment:
19 aaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| |||||||||||||||| |||||||| |||||||| ||||||| |||| | ||||  |||||||| | ||||||||    
5572651 aaaccggcttgtgaggtgaggatggcccccacttataaacaaattgtcatgccaactcctaaacgatgtgggattcttaaca 5572732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 27 - 100
Target Start/End: Original strand, 7638634 - 7638707
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||| ||||||||||||||||||| |||||||||||| ||||| |||| |||||| || |||  ||||||||||    
7638634 ttgtaaggtgaggattgcccccacttataaacacattatcaggtcatctcctatctgacgtgagactcttaaca 7638707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 65
Target Start/End: Complemental strand, 11721964 - 11721907
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgt 65  Q
    ||||| ||||||||||| ||| ||||||||||||||||||||| |||||||| |||||    
11721964 acaaccccacaaaaccggcttatgaggtgaggattgcccccacttataaacaaattgt 11721907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 33494834 - 33494741
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgc-ccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||| ||||||| ||||||||||||||| |   |||||| |||||| | |||||||| ||||| |||||||||||||| ||||||||||    
33494834 acaaccccataaaaccggcttgtgaggtgaggaataatccccacttataaatatattgtcagaccatctcctatccgatgtgggactcttaaca 33494741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 6542742 - 6542825
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||  ||||||||||| ||||||||| |  |||||||| |||||||| ||||| |||||||||||||  ||||||||||    
6542742 acaaaaccggtttgtgaggtgatgattgcccc-atttataaacagattgtcagaccatctcctatccgatgtgagactcttaaca 6542825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 87
Target Start/End: Complemental strand, 3713393 - 3713322
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgt 87  Q
    |||||| || ||| ||| |||||||||||| | || |||||||||||||||||| ||||||||||| |||||    
3713393 acaaaatcggcttttgatgtgaggattgcctcaacttataaacacattgtcaggtcatcacctatctgatgt 3713322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 30256637 - 30256578
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtca 67  Q
    ||||| |||||||||||  ||||||| |||||||||||||||  ||||||||||||||||    
30256637 acaaccccacaaaaccggtttgtgagttgaggattgcccccagttataaacacattgtca 30256578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 73
Target Start/End: Complemental strand, 13740733 - 13740675
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    |||||||||||||| ||||| |||||||| | |||| ||||||||||||||||| ||||    
13740733 cacaaaaccgacttatgaggcgaggattgtctccacttataaacacattgtcagaccat 13740675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 73
Target Start/End: Complemental strand, 13746233 - 13746175
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    |||||||||||||| ||||| |||||||| | |||| ||||||||||||||||| ||||    
13746233 cacaaaaccgacttatgaggcgaggattgtctccacttataaacacattgtcagaccat 13746175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 8026663 - 8026622
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccccca 49  Q
    ||||| ||||||||||| ||||||||||||||||||||||||    
8026663 acaaccccacaaaaccggcttgtgaggtgaggattgccccca 8026622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 30505558 - 30505470
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccaca-----tataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||| |||||||||||| |||||       |||||| |||||||||||||||| |||||||||||||  ||||||||||    
30505558 acaaaaccgacttgttaggtgaggattgtccccattaattttataaa-acattgtcaggccatctcctatccgatgtgagactcttaaca 30505470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 30505789 - 30505704
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacat-ataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| || ||| |||||||||||||| |||||| | | |||||||||||||| |||||   |||||||||||| ||||||||||    
30505789 acaaaatcggcttatgaggtgaggattgtccccactttacaaacacattgtcagaccatcttatatccgatgtgggactcttaaca 30505704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 52 - 100
Target Start/End: Complemental strand, 13353451 - 13353403
Alignment:
52 tataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||||  ||| |||||||||| ||||||||||    
13353451 tataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca 13353403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 52 - 100
Target Start/End: Complemental strand, 33796576 - 33796528
Alignment:
52 tataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||||||  ||| |||||||||| ||||||||||    
33796576 tataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca 33796528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 26 - 69
Target Start/End: Original strand, 12199728 - 12199771
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcagg 69  Q
    ||||||||||||||||| ||||||| |||||| |||||||||||    
12199728 cttgtgaggtgaggattacccccacttataaatacattgtcagg 12199771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 88
Target Start/End: Complemental strand, 3713079 - 3713009
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||||||||| |||||||||  |||||| ||| | |||||||||||||||  ||| ||| ||||||||||    
3713079 aaaaccgacttttgaggtgagatttgcccgcacttttaaacacattgtcagatcattaccaatccgatgtg 3713009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 6623435 - 6623477
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccac 50  Q
    ||||| ||||||||||| ||||| |||||||||||||||||||    
6623435 acaaccccacaaaaccggcttgtaaggtgaggattgcccccac 6623477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 14 - 99
Target Start/End: Original strand, 15082175 - 15082259
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    ||||||||||| ||||||||||||||| ||   |||| |||||||||||||||   |||||  ||| || ||||||||||||||||    
15082175 ccacaaaaccggcttgtgaggtgaggactg-ttccacttataaacacattgtctaaccatctgctaaccaatgtggaactcttaac 15082259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 97
Target Start/End: Original strand, 30849427 - 30849516
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctta 97  Q
    ||||| ||||||||||| |||| || ||||||||||| ||||| ||||| ||||||| ||   |||| | |||||||||||  |||||||    
30849427 acaaccccacaaaaccggcttgcgatgtgaggattgctcccacttataagcacattgccatatcatctcatatccgatgtgagactctta 30849516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 467661 - 467609
Alignment:
17 caaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcagg 69  Q
    |||||||| ||| ||||||||||| | ||||||| | ||||||||||||||||    
467661 caaaaccggcttatgaggtgaggacttcccccacttgtaaacacattgtcagg 467609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 26 - 70
Target Start/End: Original strand, 1788780 - 1788824
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggc 70  Q
    ||||||||||||| |||| |||||| |||||| ||||||||||||    
1788780 cttgtgaggtgagtattgtccccacttataaatacattgtcaggc 1788824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 28 - 88
Target Start/End: Complemental strand, 11085852 - 11085792
Alignment:
28 tgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||||||||| ||||| ||||| |||||| | |||| |||| |||| |||||||||||||    
11085852 tgtgaggtgagcattgctcccacttataaatatattggcaggtcatctcctatccgatgtg 11085792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 65; Significance: 2e-28; HSPs: 98)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 24647755 - 24647663
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||||||||||| |||  ||||||||||||||| |||||||||||||||||||||| ||||||||||    
24647755 acaactccacaaaaccggcttgtgaggtgaggattgccaccagttataaacacattgtccggccatcacctatccgatgtgggactcttaaca 24647663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 41666782 - 41666874
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||  ||| |||||||||| ||||||||||    
41666782 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca 41666874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 41667018 - 41667110
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||  ||| |||||||||| ||||||||||    
41667018 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca 41667110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 95291 - 95383
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||| ||||||||| |||||| |||||||||||||||||| ||||||||||||||||||  ||||||||||    
95291 acaaccccacaaaaccggcttgtgagatgaggattgtccccacttataaacacattgtcaggtcatcacctatccgatgtgtgactcttaaca 95383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 14 - 94
Target Start/End: Complemental strand, 15480375 - 15480295
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactc 94  Q
    ||||||||||  ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||    
15480375 ccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatcacctatccgatgtgggactc 15480295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 18333490 - 18333582
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||| ||||| |||||||||||||| | ||||||||    
18333490 acaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcagaccatctcctatccgatgtgggattcttaaca 18333582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 24346526 - 24346618
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||| ||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||  |||||||||||||| ||||||||||    
24346526 acaaccccataaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca 24346618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 8081138 - 8081231
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccccc-acatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||| |||||||||||||| || ||||||||||||||||||||||  |||||||||||||| ||||||||||    
8081138 acaaccccacaaaaccggcttgtgagatgaggattgccccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca 8081231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 9368654 - 9368561
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| |||||||||||||||||||| |||| |||||||||||||||| |||||| ||||||||||||   |||||||||||    
9368654 acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcacgccatctcctatccgatgtatgactcttaacag 9368561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 2063759 - 2063850
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||   ||||||||||||| ||||||||||    
2063759 acaaccccacaaaaccgacttgtgag-tgaggattgcccccacttataaacacattgtcagaccatgttctatccgatgtgggactcttaaca 2063850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 20510667 - 20510759
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||| |  || ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||  |||||||||    
20510667 acaactccacaaaactggtttttgaggtgaggattgcccccacttataaacatattgtcaggccatcacctatccgatgtggggctcttaaca 20510759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 27 - 100
Target Start/End: Original strand, 33337282 - 33337355
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| |||||||||||| |||||||| |||||||||||||||||||||| |||||| ||||||||||    
33337282 ttgtgaggtgatgattgcccccacttataaacatattgtcaggccatcacctatccaatgtgggactcttaaca 33337355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 8098376 - 8098285
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||||||||||||| || |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
8098376 acaaccccacaaaaccggcttgtgaggtgaggattgcccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 8098285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 19705962 - 19705870
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||| | ||||||||||||||||||| ||||||||||||||||||| ||  |||| ||||||||| ||||||||||    
19705962 acaactccacaaaaccggcttataaggtgaggattgcccccacttataaacacattgtcaggctatgtcctacccgatgtgggactcttaaca 19705870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 21209946 - 21210038
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||| |||| |||||| |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
21209946 acaaccccacaaaaccggcttgtgaggtgagaattgtccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 21210038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 24269896 - 24269987
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||| ||||||| ||||||||||||||||| |||| || ||||||||||||||||||||||  |||||||||||||| ||||||||||    
24269896 acaaccccataaaaccggcttgtgaggtgaggattacccc-acttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca 24269987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 25258326 - 25258418
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||||||||||||||||||||||||||||||  ||||||| ||||| |||||||  ||| ||| |||||| ||||||||||    
25258326 acaaccccacaaaaccgacttgtgaggtgaggattgcccccactgataaacatattgttaggccatgtcctgtccaatgtgggactcttaaca 25258418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 25322116 - 25322208
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||||||||||||||||||||||||||||||  ||||||| ||||| |||||||  ||| ||| |||||| ||||||||||    
25322116 acaaccccacaaaaccgacttgtgaggtgaggattgcccccactgataaacatattgttaggccatgtcctgtccaatgtgggactcttaaca 25322208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 27133018 - 27133110
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||| ||| |||||||| |||||||||||| | |||| ||||||||  ||||||||||    
27133018 acaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca 27133110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 14 - 82
Target Start/End: Original strand, 37656968 - 37657036
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatcc 82  Q
    |||||||||||||||||||||| |||||| ||||||| ||||||||||||||||| |||||||||||||    
37656968 ccacaaaaccgacttgtgaggtaaggattacccccacttataaacacattgtcagaccatcacctatcc 37657036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 9 - 85
Target Start/End: Original strand, 37782076 - 37782152
Alignment:
9 caacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgat 85  Q
    |||| ||||||||||  |||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||    
37782076 caactccacaaaaccagcttgtgaggtgatgattgcccccacttataaacacattgtcagaccatcacctatccgat 37782152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 29 - 100
Target Start/End: Original strand, 17150279 - 17150350
Alignment:
29 gtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||||||| |||||||||||| |||| ||||| |||||||||||| ||||||||||||    
17150279 gtgaggtgaggattgcccccacttataaacacattttcagaccatctcctatccgatgttgaactcttaaca 17150350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 9368889 - 9368799
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||| ||||| || || ||||||| ||||| ||||||||||| |||||||||||||||| |||||| |||||||||||||| ||||||||    
9368889 acaaccccacataatcggcttgtgaagtgagaattgcccccacttataaacacattgtcatgccatctcctatccgatgtgggactcttaa 9368799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 6637650 - 6637570
Alignment:
19 aaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||  |||| ||||||||| ||||||||||    
6637650 aaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatttcctaaccgatgtgg-actcttaaca 6637570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 17017115 - 17017208
Alignment:
7 aacaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||||||||||||||||||| ||||| |||||| |||||||||||||||  ||||||  ||||| ||| ||| ||||||||||    
17017115 aacaacaccactaaaccgacttgtgaggtgatgattgaccccacttataaacacattgtcgagccatcttctatctgatatgggactcttaaca 17017208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 17352467 - 17352551
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| |||||||||||| |||||||||||| |||||||||||||||||| |||| | ||| |||||||| ||||||||||    
17352467 cacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggtcatctcttat-cgatgtgggactcttaaca 17352551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 8 - 73
Target Start/End: Complemental strand, 24528599 - 24528534
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||    
24528599 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccat 24528534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 16 - 89
Target Start/End: Original strand, 30758332 - 30758405
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    ||||||||| ||| ||||||||||||||||||| | ||||||||||||||||||||||  ||||||||||||||    
30758332 acaaaaccggcttatgaggtgaggattgcccccccttataaacacattgtcaggccatgtcctatccgatgtgg 30758405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 1564592 - 1564680
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||||||| | ||||||| ||||||||||||||||| ||||| ||||||||||| ||||| | |||||||||||| ||||||    
1564592 acaaccccacaaaactgtcttgtgatgtgaggattgcccccacttataatcacattgtcagaccatctcttatccgatgtgggactctt 1564680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 24346762 - 24346854
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||| ||| ||||||| |||||| |||||||||||||||  | ||| |||||||| ||||||||||    
24346762 acaaccccacaaaaccggcttgtgaggtgagtattacccccacttataaatacattgtcaggccatgtcttattcgatgtgggactcttaaca 24346854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 14 - 85
Target Start/End: Complemental strand, 37781778 - 37781709
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgat 85  Q
    |||||||||||||||||||||||||||||| ||  || ||||||||||||||||| ||||||||||||||||    
37781778 ccacaaaaccgacttgtgaggtgaggattgtcc--acttataaacacattgtcagaccatcacctatccgat 37781709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 42295638 - 42295546
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||| ||||| |||||||| ||| |||||||| | |||| | ||||||| ||||||||||    
42295638 acaactccacaaaaccggcttgtgaggtgaggattgctcccacttataaacaaattatcaggccaactcctaactgatgtgggactcttaaca 42295546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 15480618 - 15480524
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattg--cccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||  ||||||| ||||||||| ||||||||||||  | |||| ||||||| ||||||||||    
15480618 acaaccccacaaaaccggcttgtgaggtgaggattgatcccccacttataaacacgttgtcaggccatgtcatatctgatgtgggactcttaaca 15480524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 27 - 98
Target Start/End: Original strand, 31181055 - 31181126
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||||||||| ||||||||||||||||||||| ||||||| | ||||||||||||||||||| | ||||||    
31181055 ttgtgaggtgatgattgcccccacatataaacatattgtcaagtcatcacctatccgatgtgggaatcttaa 31181126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 4481606 - 4481680
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||| ||||||||||||||||  ||||||||||||||||||||| |  ||||||||||||| ||||||||||    
4481606 cttgtgacgtgaggattgcccccatttataaacacattgtcaggccaacttctatccgatgtgggactcttaaca 4481680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 96
Target Start/End: Complemental strand, 15438918 - 15438848
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||||||||||||||||||||||| |||||||||||| |||| ||||| | ||||||||||| |||||||    
15438918 cttgtgaggtgaggattgcccccacttataaacacattatcagaccatctcatatccgatgtgaaactctt 15438848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 14 - 100
Target Start/End: Original strand, 29909518 - 29909604
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||| ||||||||||||||||||| |||| |||||| | |||||||||||| | |||| ||||||| | ||||||||||    
29909518 ccacaaaaccgatttgtgaggtgaggattgcctccacttataaataaattgtcaggccaactcctaaccgatgtcggactcttaaca 29909604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 6637877 - 6637804
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||| ||||| |||| ||||||||||||| |||| |||| ||||||||| ||||||||||    
6637877 ttgtgaggtgaggattgcacccacttatagacacattgtcaggtcatctcctaaccgatgtgggactcttaaca 6637804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 24531658 - 24531597
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcagg 69  Q
    ||||| |||||||| || ||||||||||||||||||||||||| ||||||||||||||||||    
24531658 acaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcagg 24531597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 6413451 - 6413531
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtg 88  Q
    ||||| |||||||| || ||| ||||||||||||||||||||| |||||||||||||||||| |||| | ||||| |||||    
6413451 acaaccccacaaaatcggcttatgaggtgaggattgcccccacttataaacacattgtcaggtcatctcatatccaatgtg 6413531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 8098610 - 8098518
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||||||||| |  | | |||||||| |||||||||||| | |||| ||||||||| ||||||||||    
8098610 acaaccccacaaaaccggcttgtgaggtgaggattgtctgcgcttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca 8098518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 30770082 - 30770166
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||  || ||||||||||||||||||||| | |||| ||||||||||| |||  |||||||||||||| ||||||||||    
30770082 acaaaaccggtttatgaggtgaggattgcccccacttttaaaaacattgtcaggtcatgtcctatccgatgtgggactcttaaca 30770166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 15 - 94
Target Start/End: Original strand, 2061970 - 2062049
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactc 94  Q
    ||||| |||| |||||||||||| |||||||||||| ||||||||||||||||||||||   ||||||| ||||| ||||    
2061970 cacaagaccggcttgtgaggtgaagattgcccccacttataaacacattgtcaggccatgttctatccggtgtgggactc 2062049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 16 - 103
Target Start/End: Original strand, 30770298 - 30770385
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacagaa 103  Q
    ||||||||  ||| ||||||||||||||||||||| |||||||||||||||| |||||  ||||||| | |||  |||||||||||||    
30770298 acaaaaccagcttatgaggtgaggattgcccccacttataaacacattgtcaagccatgtcctatccaaagtgagactcttaacagaa 30770385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 37656666 - 37656582
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||||||| ||||||||| |||  || ||||||||||||||||| |||| |||||||||| |||| ||||||||||    
37656666 ccacaaaaccggcttgtgatgtgaggatttccc--acttataaacacattgtcagaccattacctatccgacgtgggactcttaaca 37656582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 13296945 - 13296859
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||  ||||||||||||| |||||||||| |||||||| |||||||| ||| | |||| |||||| || ||||||||||    
13296945 ccacaaaaccggtttgtgaggtgagggttgcccccacttataaacaaattgtcagaccaactcctaaccgatgcgggactcttaaca 13296859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 8 - 97
Target Start/End: Original strand, 18333724 - 18333814
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccccc-acatataaacacattgtcaggccatcacctatccgatgtggaactctta 97  Q
    ||||| ||||||||||| |||||||||||| |||| ||||| || |||||||||||||  |||||||| |||||| ||||||| |||||||    
18333724 acaaccccacaaaaccggcttgtgaggtgacgattaccccccacttataaacacattgcaaggccatctcctatctgatgtgggactctta 18333814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 8 - 73
Target Start/End: Original strand, 24270130 - 24270195
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    ||||| ||||||||||| ||||||||||||| ||| ||||||| |||||| |||||||||||||||    
24270130 acaaccccacaaaaccggcttgtgaggtgagtattacccccacttataaatacattgtcaggccat 24270195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 24487677 - 24487762
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| ||||||||||||||||| ||||||| |||||||| ||| |||| ||| | |||| ||||||||  ||||||||||    
24487677 cacaaaaccggcttgtgaggtgaggattacccccacttataaacatattttcagaccaactcctaaccgatgtgagactcttaaca 24487762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 60140 - 60092
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||||||||| ||||||||||||||||||||||||| |||||||||||    
60140 ccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacat 60092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 16 - 100
Target Start/End: Original strand, 6919227 - 6919311
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| ||| | |||||||||||||||||||  ||||||||||||||||| |||| | |||  ||||||| ||||||||||    
6919227 acaaaaccggcttttaaggtgaggattgcccccactaataaacacattgtcaggtcatctcttatttgatgtgggactcttaaca 6919311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 7369783 - 7369695
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||||||||| ||||||||||||||| ||||||||| ||||||||| |  ||| |||||| | ||||| |||||| ||||||    
7369783 acaaccccacaaaaccggcttgtgaggtgaggactgcccccacttataaacacttgttcatgccatctcttatccaatgtgggactctt 7369695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 7607653 - 7607561
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||| ||||| | |||| |||||||| |||||| |||||| |||||  |||||||  ||||||||||    
7607653 acaactccacaaaaccggcttgtgaggtgaagattgtctccacttataaacagattgtcgggccataacctagtcgatgtgagactcttaaca 7607561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 12034741 - 12034657
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||| | ||||||||||||||||| ||||||  ||||||||| ||| ||||||||| | |||||||| ||| ||||||||||    
12034741 acaaaactggcttgtgaggtgaggatttcccccatttataaacacgttggcaggccatctcttatccgatatgggactcttaaca 12034657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 14 - 98
Target Start/End: Original strand, 13701099 - 13701183
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||||||||||||  || |||||| ||||||||||| ||||||||||||||| |  |||  |||||||||||||| ||||||||    
13701099 ccacaaaaccgactcttggggtgagaattgcccccacttataaacacattgtcggatcatttcctatccgatgtgggactcttaa 13701183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 8 - 72
Target Start/End: Complemental strand, 19522146 - 19522082
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggcca 72  Q
    ||||| ||||||||||| |||||||||||||||||||||||||  ||||||| |||| |||||||    
19522146 acaaccccacaaaaccggcttgtgaggtgaggattgcccccactaataaacaaattgacaggcca 19522082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 20225100 - 20225021
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgt 87  Q
    ||||| |||||||| ||||||||||||||||||||| || ||  |||||||||| ||||||| ||||  |||||||||||    
20225100 acaaccccacaaaatcgacttgtgaggtgaggattgtcctcatttataaacacactgtcaggtcatcttctatccgatgt 20225021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 14 - 89
Target Start/End: Complemental strand, 21306940 - 21306865
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    |||||| |||| ||||||||||||||||||||||||| |||||| |||||| ||| ||||  ||| ||||||||||    
21306940 ccacaataccggcttgtgaggtgaggattgcccccacttataaatacattggcagaccatgtcctgtccgatgtgg 21306865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 14 - 89
Target Start/End: Complemental strand, 21314778 - 21314703
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    |||||| |||| ||||||||||||||||||||||||| |||||| |||||| ||| ||||  ||| ||||||||||    
21314778 ccacaataccggcttgtgaggtgaggattgcccccacttataaatacattggcagaccatgtcctgtccgatgtgg 21314703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 33337480 - 33337569
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| |||||||||||  ||||||| ||||||||||||| || || ||   |||||||||| ||||||||||||||||||| |||||||||||    
33337480 acaaccccacaaaaccggtttgtgagatgaggattgcccc-acttacaa---cattgtcaggtcatcacctatccgatgtgggactcttaacag 33337569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 17584232 - 17584178
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||| ||||||||||||||||| | |||||||||||||| ||||||||||||||    
17584232 acaactccacaaaaccgacttgtaaagtgaggattgccccaacatataaacacat 17584178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 6413682 - 6413773
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||| ||||||| ||| |||||||||||||| ||| || ||||||||||||||||   |||| | |||||||||||| ||||||||||    
6413682 acaaccccaaaaaaccggcttatgaggtgaggattgtccctacttataaacacattgtca-atcatctcatatccgatgtgggactcttaaca 6413773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 15439046 - 15438986
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    ||||| ||| ||||| |||||||||||||| |||||||||||| |||| ||||||||||||    
15439046 acaaccccataaaactgacttgtgaggtgatgattgcccccacttatagacacattgtcag 15438986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 28510150 - 28510062
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||||||||| ||| |||| |||||||||||  ||| |||||||||||||||||| |||| | |||| ||||| | ||||||    
28510150 acaaccccacaaaaccggcttatgagatgaggattgccttcacttataaacacattgtcaggtcatctcttatctgatgttggactctt 28510062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 15 - 62
Target Start/End: Original strand, 170583 - 170630
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||||||||| ||||||||||||||| ||||||||| |||||||||||    
170583 cacaaaaccggcttgtgaggtgaggactgcccccacttataaacacat 170630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 25 - 100
Target Start/End: Original strand, 3859350 - 3859425
Alignment:
25 acttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||| || ||| |||||||||||| ||||| |||   ||||||||| ||| ||||||||||    
3859350 acttgtgaggtgaggattgtcctcacttataaacacattatcaggtcatgttctatccgatatgggactcttaaca 3859425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 73
Target Start/End: Complemental strand, 43117931 - 43117876
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    ||||||| |||||||| |||||||||||| ||  ||||||||||||||||||||||    
43117931 aaaaccggcttgtgagatgaggattgccctcatttataaacacattgtcaggccat 43117876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 8287860 - 8287771
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||| ||||||||||| ||||||||||| |||||| |||||| |||||||| |||| ||| ||| | |||| ||||||||  ||||||||    
8287860 acaaccccacaaaaccggcttgtgaggtggggattg-ccccacttataaacaaattgccagaccaactcctagccgatgtgtgactcttaa 8287771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 13296726 - 13296640
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||| | ||||||||||||||||||||||||| |||||| | |||||||  ||| | | || ||||||||||| | ||||||    
13296726 ccacaaaactggcttgtgaggtgaggattgcccccacttataaataaattgtcaaaccaactcttaaccgatgtggaatttttaaca 13296640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 13700621 - 13700707
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgat-gtggaactcttaaca 100  Q
    |||||||||| ||| ||||||||| |||| ||  || |||||||||||||||| | |||| |||||||||| |||| ||||||||||    
13700621 cacaaaaccggcttttgaggtgagaattgtccaaacttataaacacattgtcaagtcatctcctatccgatggtgggactcttaaca 13700707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 17352711 - 17352785
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||| |||| ||||||| |||||||||||||| ||| |||| |  || |||||||| ||||||||||    
17352711 cttgtgaggtgaagattacccccacttataaacacattgttaggtcatctctcattcgatgtgggactcttaaca 17352785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 25258119 - 25258161
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccac 50  Q
    ||||| ||||||||||| |||||||||||||||||||||||||    
25258119 acaaccccacaaaaccggcttgtgaggtgaggattgcccccac 25258161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 25321909 - 25321951
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccac 50  Q
    ||||| ||||||||||| |||||||||||||||||||||||||    
25321909 acaaccccacaaaaccggcttgtgaggtgaggattgcccccac 25321951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 38731646 - 38731720
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||  |||||| | ||| |||||| | ||||||||| |||| ||||||||||||||||| |||||||    
38731646 cttgtgaggtggtgattgctctcacttataaataaattgtcaggtcatctcctatccgatgtggaacacttaaca 38731720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 68
Target Start/End: Complemental strand, 38976986 - 38976932
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    |||||||||||  ||||||||||||||||| ||| || |||||||||||||||||    
38976986 ccacaaaaccggtttgtgaggtgaggattgtcccaacttataaacacattgtcag 38976932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 11895948 - 11896032
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||| || ||||||| ||| ||||||||| || |||||| ||||||||||| |||||||||||| ||||   ||||||||||    
11895948 cacaaaactgatttgtgagatgatgattgcccc-acttataaatacattgtcaggtcatcacctatccaatgtaagactcttaaca 11896032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 57
Target Start/End: Original strand, 29909746 - 29909795
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaa 57  Q
    ||||| ||||||||||| |||||||||||||||||||| |||| ||||||    
29909746 acaactccacaaaaccggcttgtgaggtgaggattgcctccacttataaa 29909795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 38731870 - 38731923
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    ||||||| |||||||||||||||||||||  | ||| |||||||||||||||||    
38731870 cacaaaatcgacttgtgaggtgaggattgttctcacttataaacacattgtcag 38731923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 7092208 - 7092121
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||||||| | ||||||||||||||||||||||||| | |||||||||  || |||||||   ||||| |||||| ||||||    
7092208 acaaccccacaaaactggcttgtgaggtgaggattgcccccac-tctaaacacatgttcgggccatctgttatccaatgtgggactctt 7092121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 19522379 - 19522288
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| || ||||||||||||  |||| |||||| |||||| | |||||||| ||| | |||| ||||||||| ||||||||||    
19522379 acaaccccacaaaatcggcttgtgaggtgattattg-ccccacttataaataaattgtcagtccaactcctaaccgatgtgggactcttaaca 19522288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 37405148 - 37405056
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||| ||||||| ||||||||||||| || |||||| || |||| ||||| |  | | ||||||| ||||||||||    
37405148 acaaccccacaaaaccggcttttgaggtggggattgcccccacttacaaacactttttcagaccatctctcaactgatgtgggactcttaaca 37405056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 27 - 98
Target Start/End: Original strand, 11896729 - 11896800
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||||||||| |||||||||||| ||| |||||||| ||| | ||| | ||||||||||||  ||||||||    
11896729 ttgtgaggtgatgattgcccccacttattaacacattatcaagtcattatctatccgatgtgcgactcttaa 11896800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 37 - 100
Target Start/End: Complemental strand, 13358431 - 13358368
Alignment:
37 aggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||| ||||||| ||||||||||||||||| | ||| |||||| ||||||  ||||||||||    
13358431 aggattacccccacttataaacacattgtcagccaatctcctatctgatgtgagactcttaaca 13358368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 17899507 - 17899550
Alignment:
30 tgaggtgaggattgcccccacatataaacacattgtcaggccat 73  Q
    ||||||||||||||||||||| |||||||||||  |||||||||    
17899507 tgaggtgaggattgcccccacttataaacacatgttcaggccat 17899550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 20510910 - 20510957
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgt 65  Q
    |||||||||||||||||||||||||  |||||| |||||| |||||||    
20510910 aaaaccgacttgtgaggtgaggattatccccacttataaatacattgt 20510957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 17 - 68
Target Start/End: Original strand, 32908752 - 32908803
Alignment:
17 caaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    ||||||||  ||||||||||| ||||||| |||| |||||||||||||||||    
32908752 caaaaccggtttgtgaggtgatgattgcctccacttataaacacattgtcag 32908803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 14 - 68
Target Start/End: Original strand, 16571491 - 16571545
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    |||||||||| | || ||||||||||||| ||||||| || ||||||||||||||    
16571491 ccacaaaaccaatttatgaggtgaggatttcccccacttaaaaacacattgtcag 16571545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 26 - 100
Target Start/End: Complemental strand, 24528815 - 24528742
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| | ||||||||| || |||| |||||||||||||||||  ||| || ||||||| ||||||||||    
24528815 cttgtgaggttatgattgcccc-acttatatacacattgtcaggccatgtcctctcagatgtgggactcttaaca 24528742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 29239964 - 29239881
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||| | ||||||||||| |||| |||| || |||||||||||||||| | ||||||||||| ||||||  ||||||||||    
29239964 ccacaaaacc-atttgtgaggtgatgattacccc-acttataaacacattgtca-gacatcacctatcagatgtgagactcttaaca 29239881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 27 - 68
Target Start/End: Original strand, 2985272 - 2985313
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcag 68  Q
    |||||||||||||||| ||||||  |||||||||||||||||    
2985272 ttgtgaggtgaggattacccccaattataaacacattgtcag 2985313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 26 - 67
Target Start/End: Original strand, 6919471 - 6919512
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacattgtca 67  Q
    ||||||||||||| |||| |||||| ||||||||||||||||    
6919471 cttgtgaggtgagaattgtccccacttataaacacattgtca 6919512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 28 - 100
Target Start/End: Complemental strand, 15590213 - 15590140
Alignment:
28 tgtgaggtgaggattgccc-ccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||||||||||| |||| ||||||  ||||||||| ||||| | ||| |||||||  ||||||||||    
15590213 tgtgaggtgaggattgccctccacttataaatccattgtcagaccatctcatattcgatgtgagactcttaaca 15590140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 17 - 62
Target Start/End: Original strand, 16707059 - 16707104
Alignment:
17 caaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||||||  |||||||||| |||||||||||||| |||||||||||    
16707059 caaaaccagcttgtgaggttaggattgcccccacttataaacacat 16707104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 17015904 - 17015961
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgt 65  Q
    ||||| |||||||| || ||||||||||||| ||||||| ||| |||||||| |||||    
17015904 acaaccccacaaaatcggcttgtgaggtgagaattgccctcacttataaacatattgt 17015961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 25436259 - 25436206
Alignment:
9 caacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||| ||||||||||| ||||||||||||||||| |||  || |||||||||||    
25436259 caaccccacaaaaccggcttgtgaggtgaggatttcccttacttataaacacat 25436206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 25 - 98
Target Start/End: Original strand, 36040518 - 36040591
Alignment:
25 acttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||||||||||| ||||||  |||| |||||||||||| ||||  ||||  ||||| |||||| |||||||||    
36040518 acttgtgaggtgatgattgcaaccacttataaacacattatcagatcatcttctatctgatgtgaaactcttaa 36040591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 28 - 100
Target Start/End: Complemental strand, 18885500 - 18885429
Alignment:
28 tgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||| ||| | |||| ||||||||||||||||| |||||   ||| |||||||| ||||||||||    
18885500 tgtgaggtgagggttgtctccacttataaacacattgtcagaccatcttttat-cgatgtgggactcttaaca 18885429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 14 - 98
Target Start/End: Original strand, 26137140 - 26137224
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    |||||||||||  ||||||| |||||||||||||||  ||||||||  ||||||   |||  ||||| |||||||| ||||||||    
26137140 ccacaaaaccggtttgtgagatgaggattgcccccatttataaacatgttgtcatatcatttcctattcgatgtgggactcttaa 26137224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0519 (Bit Score: 61; Significance: 5e-26; HSPs: 2)
Name: scaffold0519
Description:

Target: scaffold0519; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 2210 - 2118
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||  ||| |||||||||| ||||||||||    
2210 acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca 2118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0519; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 1975 - 1882
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacag 101  Q
    ||||| ||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||| ||||  ||| |||||||||| |||||||||||    
1975 acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtccgatgtgggactcttaacag 1882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129 (Bit Score: 58; Significance: 3e-24; HSPs: 2)
Name: scaffold0129
Description:

Target: scaffold0129; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 14362 - 14281
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtgg 89  Q
    ||||| ||||||||||| |||||||||||| ||||| |||||| ||||||||||||||||| ||||||||||||||||||||    
14362 acaaccccacaaaaccggcttgtgaggtgatgattgtccccacttataaacacattgtcagaccatcacctatccgatgtgg 14281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 45 - 99
Target Start/End: Complemental strand, 14560 - 14506
Alignment:
45 ccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    |||||| ||||||||||||||||| |||||||||||||||||||| |||||||||    
14560 ccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaac 14506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0334 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: scaffold0334
Description:

Target: scaffold0334; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 4454 - 4546
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | |||| | ||||||| ||||||||||    
4454 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaactgatgtggcactcttaaca 4546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: scaffold0047
Description:

Target: scaffold0047; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 15 - 99
Target Start/End: Complemental strand, 12699 - 12615
Alignment:
15 cacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    ||||||| ||||||||||||||||||||||||||||||||||| |||||||||  |||||||||||||||  ||| |||||||||    
12699 cacaaaatcgacttgtgaggtgaggattgcccccacatataaatacattgtcaaaccatcacctatccgacatgggactcttaac 12615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 12930 - 12848
Alignment:
18 aaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||  |||| || |||||||||||||||| ||||||  |||||||| |||||||||||| ||||||||  |||||||||    
12930 aaaaccggtttgtaagatgaggattgcccccacttataaattcattgtcaagccatcacctattcgatgtggggctcttaaca 12848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0400 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: scaffold0400
Description:

Target: scaffold0400; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 3904 - 3813
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccccc-acatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||| ||||||||| | ||||||||||||||||||||||| || ||| |||||||||||||||||||| ||||||||||||| ||||||||    
3904 acaaccccacaaaactggcttgtgaggtgaggattgccccccacttattaacacattgtcaggccatcagctatccgatgtgggactcttaa 3813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0365 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: scaffold0365
Description:

Target: scaffold0365; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 4548 - 4457
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgccccc-acatataaacacattgtcaggccatcacctatccgatgtggaactcttaa 98  Q
    ||||| ||||||||| | ||||||||||||||||||||||| || ||| |||||||||||||||||||| ||||||||||||| ||||||||    
4548 acaaccccacaaaactggcttgtgaggtgaggattgccccccacttattaacacattgtcaggccatcagctatccgatgtgggactcttaa 4457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0766 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: scaffold0766
Description:

Target: scaffold0766; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 6333 - 6241
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||| || ||||||||||||||||||||||||| ||||||||||||||||| | ||| | |||| ||||||| ||||||||||    
6333 acaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcagactatctcttatctgatgtgggactcttaaca 6241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 288682 - 288770
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactctt 96  Q
    ||||| ||||||||||  ||||||||||||||||||| |||| ||||||| |||||||||| ||||| |||||||||||||| ||||||    
288682 acaactccacaaaaccagcttgtgaggtgaggattgcgcccagatataaatacattgtcagaccatctcctatccgatgtgggactctt 288770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 8 - 103
Target Start/End: Complemental strand, 56518 - 56423
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaacagaa 103  Q
    ||||| ||||||||||| |||||||||||| |||||||| ||  |||||||| ||||||||  || | |||| ||||||||| |||||||||||||    
56518 acaaccccacaaaaccggcttgtgaggtgatgattgcccacagttataaacaaattgtcagatcaactcctaaccgatgtgggactcttaacagaa 56423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 42 - 99
Target Start/End: Complemental strand, 429898 - 429841
Alignment:
42 tgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||    
429898 tgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaac 429841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0092 (Bit Score: 49; Significance: 8e-19; HSPs: 2)
Name: scaffold0092
Description:

Target: scaffold0092; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 5714 - 5622
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| ||||| || |||||||| ||||||| |||||||||||||||| ||||||  ||||| ||||||| ||||||||||    
5714 acaaccccacaaaaccggcttgtaagatgaggattacccccacttataaacacattgtcatgccatcttctatctgatgtgggactcttaaca 5622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0092; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 32 - 100
Target Start/End: Complemental strand, 5925 - 5857
Alignment:
32 aggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||| || ||| |||||||| ||||||| ||||||  ||||||||||||||||| ||||||    
5925 aggtgaggattgtcctcacttataaacatattgtcatgccatcttctatccgatgtggaactgttaaca 5857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 49; Significance: 8e-19; HSPs: 1)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 20626 - 20542
Alignment:
16 acaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||  ||||| ||||||||||||||||||  ||||||||||||||||||||||  ||| |||||||||| ||||||||||    
20626 acaaaaccagcttgtaaggtgaggattgcccccaattataaacacattgtcaggccatatcctgtccgatgtgggactcttaaca 20542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0692
Description:

Target: scaffold0692; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 8 - 99
Target Start/End: Original strand, 5779 - 5870
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    ||||| || |||||||| |||||||| |||||||||||||||| ||||||||||||||||| | ||  | |||||||||||| |||||||||    
5779 acaaccccgcaaaaccggcttgtgagatgaggattgcccccacttataaacacattgtcagactatgtcttatccgatgtgggactcttaac 5870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 5569 - 5628
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtca 67  Q
    ||||| || |||||||| ||||||| ||||||||||||||||| ||||||||||||||||    
5569 acaaccccgcaaaaccggcttgtgaagtgaggattgcccccacttataaacacattgtca 5628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0083
Description:

Target: scaffold0083; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 51295 - 51236
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtca 67  Q
    ||||| ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||    
51295 acaaccccacaaaactgacttgtgaggtgaggattgcccccacttataaacacattgtca 51236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 8 - 99
Target Start/End: Original strand, 69558 - 69649
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaac 99  Q
    ||||| ||| |||||||  |||||||||||||||||||||||| |||||||| |||||||||||||   ||||||| ||||| |||||||||    
69558 acaaccccataaaaccggtttgtgaggtgaggattgcccccacttataaacagattgtcaggccatgttctatccgttgtgggactcttaac 69649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 14 - 100
Target Start/End: Complemental strand, 121606 - 121520
Alignment:
14 ccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||||||||| ||||||| | |||||| |||||||| || ||||||||||||| | ||||||||||||||||| | ||||||||||    
121606 ccacaaaaccggcttgtgatgggaggatggcccccacttacaaacacattgtcatgtcatcacctatccgatgtaggactcttaaca 121520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0481 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0481
Description:

Target: scaffold0481; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 3496 - 3588
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||| |||||||||||| ||||| |||||| |||||||| ||||||| | || | |||| ||||||||| ||||||||||    
3496 acaaccccacaaaaccggcttgtgaggtgaagattgtccccacttataaacaaattgtcatgtcaactcctaaccgatgtgggactcttaaca 3588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0048
Description:

Target: scaffold0048; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 81901 - 81809
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| ||||||||||||||||| ||||||  |||| |||||| |||||||| |||||||||||||   || |||||||||| ||||||||||    
81901 acaaccccacaaaaccgacttgtaaggtgaaaattgtccccacttataaacatattgtcaggccatgttctgtccgatgtgggactcttaaca 81809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 82135 - 82043
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    ||||| |||||||||||  |||| |  |||||||| ||||||  |||| |||||||||||||||||  | | || ||||||| ||||||||||    
82135 acaaccccacaaaaccggtttgtaatttgaggatttcccccatttatatacacattgtcaggccatgtcatgtctgatgtgggactcttaaca 82043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0459 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 2)
Name: scaffold0459
Description:

Target: scaffold0459; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 21 - 87
Target Start/End: Complemental strand, 13147 - 13081
Alignment:
21 accgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgt 87  Q
    |||| |||||||||||| |||||||||||| || ||||| ||||| || ||||||||||||||||||    
13147 accggcttgtgaggtgatgattgcccccacttacaaacatattgttagaccatcacctatccgatgt 13081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0459; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 13373 - 13300
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||| | ||| || |||||||||||||||| ||||||||| ||||||   ||||||||||    
13373 ttgtgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaaca 13300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 4)
Name: scaffold0366
Description:

Target: scaffold0366; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 21 - 87
Target Start/End: Complemental strand, 10788 - 10722
Alignment:
21 accgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgt 87  Q
    |||| |||||||||||| |||||||||||| || ||||| ||||| || ||||||||||||||||||    
10788 accggcttgtgaggtgatgattgcccccacttacaaacatattgttagaccatcacctatccgatgt 10722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 21 - 87
Target Start/End: Complemental strand, 14454 - 14388
Alignment:
21 accgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgt 87  Q
    |||| |||||||||||| |||||||||||| || ||||| |||||||| || |||||||||||||||    
14454 accgccttgtgaggtgatgattgcccccacttacaaacatattgtcagaccgtcacctatccgatgt 14388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 11014 - 10941
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||| | ||| || |||||||||||||||| ||||||||| ||||||   ||||||||||    
11014 ttgtgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaaca 10941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 14680 - 14607
Alignment:
27 ttgtgaggtgaggattgcccccacatataaacacattgtcaggccatcacctatccgatgtggaactcttaaca 100  Q
    |||||||||||||||||| | ||| || |||||||||||||||| ||||||||| ||||||   ||||||||||    
14680 ttgtgaggtgaggattgcactcacttacaaacacattgtcaggctatcacctattcgatgtatgactcttaaca 14607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0181 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0181
Description:

Target: scaffold0181; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 20998 - 20932
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacattgtcaggccatc 74  Q
    ||||| ||||||||||| ||||||||||||||||| ||  ||| |||||| |||||||||| |||||    
20998 acaaccccacaaaaccggcttgtgaggtgaggattaccttcacttataaatacattgtcagaccatc 20932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 67544 - 67490
Alignment:
8 acaacaccacaaaaccgacttgtgaggtgaggattgcccccacatataaacacat 62  Q
    ||||| |||||||| ||  |||| ||||||||||||||||||| |||||||||||    
67544 acaactccacaaaatcggtttgtaaggtgaggattgcccccacttataaacacat 67490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 67319 - 67283
Alignment:
26 cttgtgaggtgaggattgcccccacatataaacacat 62  Q
    |||||||||||| |||||||||||| |||||||||||    
67319 cttgtgaggtgatgattgcccccacttataaacacat 67283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 619 times since January 2019
Visitors: 2233