View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0150-INSERTION-3 (Length: 199)
Name: NF0150-INSERTION-3
Description: NF0150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0150-INSERTION-3 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 3e-99; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 9 - 199
Target Start/End: Original strand, 28198614 - 28198804
Alignment:
| Q |
9 |
cctttgcttttaaagattttttcaaagaatggtgtgccgaatgatcatctcccttttatggtgtatgctcaagtttttaaacttggttttaatcatgatt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
28198614 |
cctttgcttttaaagattttttcaaagaatggtgtgccgaatgatcatctcccttttatggtgtatgctcaagtttttaaacttgggtttgatcatgatt |
28198713 |
T |
|
| Q |
109 |
gttttgtttgtaatggtttcatttctgcttttgggtgttctgggtttatgaaaaatgcgtgtaaagtgtttgatgaaagtcctgaaaggga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28198714 |
gttttgtttgtaatggtttcatttctgcttttgggtgttctgggtttatgaaaaatgcgtgtaaagtgtttgatgaaagtcctgaaaggga |
28198804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 73 - 199
Target Start/End: Original strand, 28372140 - 28372266
Alignment:
| Q |
73 |
atgctcaagtttttaaacttggttttaatcatgattgttttgtttgtaatggtttcatttctgcttttgggtgttctgggtttatgaaaaatgcgtgtaa |
172 |
Q |
| |
|
|||||||| | ||||||||||| ||| || |||||||||||||||||||| ||| ||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
28372140 |
atgctcaaatatttaaacttgggtttgattttgattgttttgtttgtaatgatttgatttcggcttttgggtgttctgggtttccgaaaagtgcgtgtaa |
28372239 |
T |
|
| Q |
173 |
agtgtttgatgaaagtcctgaaaggga |
199 |
Q |
| |
|
| ||||||||||||||||| ||||||| |
|
|
| T |
28372240 |
aatgtttgatgaaagtcctcaaaggga |
28372266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 104 - 199
Target Start/End: Complemental strand, 44769308 - 44769213
Alignment:
| Q |
104 |
tgattgttttgtttgtaatggtttcatttctgcttttgggtgttctgggtttatgaaaaatgcgtgtaaagtgtttgatgaaagtcctgaaaggga |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||| |||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
44769308 |
tgattgttttgtttgtaatgatttcatttcggcttttgggtgttctgggtttccgaaaagtgcgtgtaaaatgtttgatgaaagtcctcaaaggga |
44769213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 39
Target Start/End: Original strand, 2377681 - 2377711
Alignment:
| Q |
9 |
cctttgcttttaaagattttttcaaagaatg |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2377681 |
cctttgcttttaaagattttttcaaagaatg |
2377711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 477 times since January 2019
Visitors: 2226