View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0150-INSERTION-5 (Length: 95)
Name: NF0150-INSERTION-5
Description: NF0150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0150-INSERTION-5 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 1e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 6 - 95
Target Start/End: Complemental strand, 10871822 - 10871733
Alignment:
Q |
6 |
cacatacatgtgtctgtaaattagaggaaaaataatcaatccactacatgataagttttcatcacgtacattaaatttctttgcacgcct |
95 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10871822 |
cacatacatgtctctgtaaattagaggaaaaataatcaatccactacatgataagttttcatcacgtacattaaatttctttgcacgcct |
10871733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 561 times since January 2019
Visitors: 2229