View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0150-INSERTION-6 (Length: 206)

Name: NF0150-INSERTION-6
Description: NF0150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0150-INSERTION-6
NF0150-INSERTION-6
[»] chr3 (1 HSPs)
chr3 (7-206)||(47365589-47365787)


Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 7 - 206
Target Start/End: Original strand, 47365589 - 47365787
Alignment:
7 atataattgataattgaaatgaggattgctttcnnnnnnnnnnnnnccctaaaacaaaaatgataaattttccgaactgaggatttggctagatgtatcg 106  Q
    |||||||||||||||||||||||||||||||||             |||||||||||||||||||||||||| ||||||||||||||||||||||||||     
47365589 atataattgataattgaaatgaggattgctttctttttttctttttccctaaaacaaaaatgataaattttctgaactgaggatttggctagatgtatca 47365688  T
107 ctccaagcagtacctgtcctgcactgggtgtaaccaaagtccttgctgtcttgacacgccagtttttggttaatgctccatatttatcttccttattact 206  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47365689 ctccaagcagtacctgtcctgcactgggtgtaaccaaa-tccttgctgtcttgacacgccagtttttggttaatgctccatatttatcttccttattact 47365787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University