View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0150-INSERTION-6 (Length: 206)
Name: NF0150-INSERTION-6
Description: NF0150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0150-INSERTION-6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 7 - 206
Target Start/End: Original strand, 47365589 - 47365787
Alignment:
| Q |
7 |
atataattgataattgaaatgaggattgctttcnnnnnnnnnnnnnccctaaaacaaaaatgataaattttccgaactgaggatttggctagatgtatcg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47365589 |
atataattgataattgaaatgaggattgctttctttttttctttttccctaaaacaaaaatgataaattttctgaactgaggatttggctagatgtatca |
47365688 |
T |
 |
| Q |
107 |
ctccaagcagtacctgtcctgcactgggtgtaaccaaagtccttgctgtcttgacacgccagtttttggttaatgctccatatttatcttccttattact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365689 |
ctccaagcagtacctgtcctgcactgggtgtaaccaaa-tccttgctgtcttgacacgccagtttttggttaatgctccatatttatcttccttattact |
47365787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University